Содержание кальция в крови норма: какова норма, сколько кальция нужно человеку и чем опасны отклонения от нормы?

Содержание

Кальций в сыворотке — ЕМЦ

Кальций (Са) — самый распространенный неорганический элемент в организме человека.

Биологическая роль кальция в организме велика

  • кальций поддерживает нормальный сердечный ритм, как и магний, кальций способствует здоровью сердечно-сосудистой системы в целом
  • участвует в обмене железа в организме, регулирует ферментную активность 
  • способствует нормальной работе нервной системы, передаче нервных импульсов 
  • действуя сообща, фосфор и кальций делают кости крепкими, а зубы здоровыми 
  • участвует в свертывании крови, регулирует проницаемость клеточных мембран 
  • нормализует работу некоторых эндокринных желез 
  • свойства кальция помогают избавиться от бессонницы 
  • участвует в сокращении мышц

Содержание кальция в организме. Норма кальция

Норма кальция (Са) в сыворотке крови: 2, 02 — 2, 6 ммоль/л

Почти все содержание кальция — от 1 до 1, 5 кг — это кости и зубы. Лишь 1% кальция содержится в сыворотке крови

Неорганический элемент кальций поступает в организм человека с пищей. Усвоение кальция происходит в кишечнике, обмен в костях. Из организма кальций выводят почки. Равновесие этих процессов обеспечивает постоянство содержания кальция в крови.

Выведение и усвоение кальция находится под контролем гормонов (паратгормон и др.) и кальцитриола — витамина D3. Для того, чтобы происходило усвоение кальция, в организме должно быть достаточно витамина Д.

Кальций и питание. В каких продуктах содержится кальций

Наряду с железом, кальций — самое дефицитное минеральное вещество в организме женщины. Для восполнения суточной нормы кальция человек должен употреблять в пищу содержащие кальций продукты питания. Главные источники кальция — творог, молоко, молочные продукты, сыры, соевые, бобы, сардины, лосось, арахис, грецкие орехи, семечки подсолнуха, зеленые овощи (брокколи, сельдерей, петрушка, капуста), чеснок, редька.

Важно отметить, что действие кальция в продуктах, богатых кальцием, может быть нейтрализовано определенными продуктами питания. Антагонисты кальция — щавелевая кислота (содержится в шоколаде, щавеле, шпинате), большое количество жира, фитиновая кислота (содержится в зернах) — мешают его усвоению.

Кальций при беременности

Недостаток кальция может привести к «вымыванию» кальция из костей и зубов будущей мамы, что приводит в дальнейшем к проблемам с зубами и раннему развитию остеопороза. Нехватка кальция при беременности может быть компенсирована только через употребление молочных продуктов, так как содержание кальция в продуктах других категорий в несколько раз ниже.

Чтобы ребенок кальций получал в нормальном количестве, беременная должна обязательно принимать и рекомендованные гинекологом комплексы витаминов для беременных на протяжении всей беременности и в период кормления грудью.

Оценить содержание кальция в рационе беременной несложно, если она ведет дневник питания. Но самый простой способ — сделать анализ кальция — сдать биохимический анализ крови на микроэлементный состав.

Препараты кальция

Однако зачастую одного употребления кальция с продуктами питания бывает недостаточно. Для того, чтобы восполнить недостаток кальция врач может назначить препараты кальция, восполняющие суточную норму. Назначение препаратов кальция обязательно предваряет биохимический анализ крови на определение кальция.

Препараты кальция — таблетки, поливитамины, минеральные препараты — необходимо принимать, следуя строго рекомендациям врача, поскольку превышение суточной нормы кальция (свыше 2000 мг) может привести к токсическому отравлению организма.

Анализ кальция назначается для диагностики остеопороза, при болях в костях, заболеваниях мышц, желудочно-кишечного тракта и сердечно-сосудистой системы, онкологических заболеваниях. Определение кальция в крови назначается и при подготовке к оперативному вмешательству.

Переизбыток кальция или гиперкальцемия могут вызываться следующими нарушениями в организме человека

  • повышенная функция паращитовидных желез (первичный гиперпаратиреоз) 
  • злокачественные опухоли с поражением костей (метастазы, миелома, лейкозы) 
  • саркоидоз 
  • избыток витамина Д 
  • обезвоживание 
  • тиреотоксикоз 
  • острая почечная недостаточность

Недостаток кальция или гипокальциемия

— симптом следующих заболеваний

  • рахит (дефицит витамина D) 
  • остеопороз 
  • остеомаляция 
  • снижение функции щитовидной железы 
  • хроническая почечная недостаточность 
  • дефицит магния 
  • панкреатит 
  • механическая желтуха, печеночная недостаточность

Нехватка кальция может быть связана и применением лекарственных средств.

Дефицит кальция в организме проявляется судорогами мышц, нервозностью, бессонницей.

Изменение кальция крови может указать на необходимость дополнительного обследования организма. Сделать биохимический анализ крови на кальций или полный биохимический анализ крови, пройти полное обследование вы всегда можете, обратившись в наш медицинский центр. В своей работе мы используем только одноразовые материалы. В нашем центре выполняется много других анализов. Сдать анализы можно в любое время, без записи и очередей.

Таблица содержания кальция в 100 г продукта (в мг).

Для женщин после менопаузы и для мужчин старше 50 лет ежедневная потребность в кальции составляет 1500 мг. В более молодом возрасте ежедневная потребность в кальции составляет 1000 мг.


ПродуктКальций в мг
Молоко, яйцо
Коровье молоко 2,5% — 3,5%120
Обезжиренное молоко125
Соевое молоко
80
Кефир120
Сметана 10%80
Яйцо 1шт. (около 50 г)58
Сыры и творог
Пармезан1300
Российский сыр1000
Латвийский сыры900
Твердые сыры (в среднем)800-1200
Сыр «Рокфор»
750
Козий сыр500
Творог (обезжиренный)120
Бобовые
Соевые бобы240
Фасоль194
Бобы100
Горох50
Орехи, семена
Кунжут780
Миндаль250
Лещина225
Фисташки130
Семена подсолнуха100
Грецкие орехи90
Арахис60
Рыба, морепродукты
Сардины атлантические (консервы)380
Крабы100
Креветки
90
Анчоусы82
Устрицы82
Карп50
Треска25
Щука20
Форель19
Лосось10
Мясо и мясопродукты
Цыпленок28
Телятина
26
Курятина10
Печень говяжья10
Крольчатина9
Говядина5
Свинина5
Баранина3
Колбаса22
Сосиски12
Ветчина11
Зерновые
Зерновой хлеб55
Хлеб из отрубей23
Белый хлеб52
Овсяные хлопья50
Хлеб ржаной 30
Гречка21
Рис33
Манная крупа18
Перловая крупа15
Овощи
Базилик370
Зелень петрушки245
Савойская капуста212
Белокочанная капуста210
Кресс-салат180
Лук-шнитт130
Укроп126
Брокколи105
Зеленые консервированные оливки96
Лук зеленый86
Салат листовой37
Морковь35
Редис35
Огурцы15
Помидоры14
Картофель6
Фрукты, ягоды (сухофрукты)
Курага80
Инжир вяленый54
Изюм50
Апельсины42
Малина40
Киви38
Мандарины33
Смородина30
Земляника26
Финики21
Виноград18
Ананасы16
Абрикосы16
Арбуз10
Груши10
Бананы9
Персики8
Яблоки7
Дыня6
Кондитерские изделия
Шоколад темный60
Мороженое молочное140
Мороженое фруктовое20
Печенье песочное14
Мед натуральный4

Возврат к списку

Биохимический анализ крови на определение уровеня кальция в организме человека, производимый в медицинской лаборатории в Сочи

Кальций (Микроэлементы в сыворотке крови)

Биохимический анализ крови на кальций представляет собой клиническое исследование содержания общего кальция в сыворотке крови.

Подготовка к исследованию:

  • Забор крови производится натощак
  • С последнего пртема пищи должно пройти не более 8 часов
  • Анализ проводить до начала приема лекарственных средств
  • За сутки отказаться от алкоголя, жирной пищи и физических нагрузок
  • Не проводить исседование после УЗИ, рентгена, флюрографии

Тип биоматериала: венозная кровь

Методы исследования: иммуноферментный анализ

Единицы измерения: Ммоль/л

Сроки выполнения: 1 день

Что такое анализ крови на кальций?

Кальций является самым распространенным неорганическим элементов, содержащимся в организмах людей.  Его дефицит или переизбыток негативно сказывается на здоровье и самочувствии человека. Выявить уровень кальция в крови позволяет биохимический анализ сыворотки крови, производимый в медицинской лаборатории путем забора материала из вены.

Симптомы, являющиеся показанием для сдачи крови на содержание кальция:
  • Головные боли, мигрень, головокружение;
  • Выпадение волос, трещины на коже, разрушение ногтей;
  • Слабость;
  • Тахикардия, нарушение свертываемости крови, стенокардия;
  • Судороги конечностей.

Признаки нарушения обмена кальция

Существует две формы нарушения обмена кальция: гипокальциемия и гиперкальциемия.

Гипокальциемия (снижения уровня кальция в крови – менее 2,1 ммоль/л) сопровождает панкреатит, переливание цитратной крови в больших количествах, нарушения всасывания тонким кишечником, дефицит витамина D и т.д.

Клинически проявляет себя следующими симптомами:

  • Нервно-мышечная возбудимость;
  • Тетания;
  • Тахикардия.

Гиперкальциемия ( показатель кальция плазмы превышает референсные значения — более 2,6 ммоль/г) наблюдается после переливания цитратной крови, при наличии проблем с паращитовидной железой и в случае разрушения костей.

Клинические симптомы:

  • Утомляемость и слабость;
  • Заторможенность;
  • Проблемы с желудочно-кишечным трактом (запор, рвота, тошнота и повышенное газообразование).

Расшифровка анализа крови на кальций

 В среднем 99% кальция, находящегося в организме человека, приходится на зубы и кости. Сыворотка крови содержит только 1% данного элемента.

Норма содержания кальция Са в сыворотке крови составляет 2,15-2,50 ммоль/л.

Человек получает кальций из продуктов питания, поэтому рекомендуется изучить свой рацион и изменить его таким образом, чтобы в сутки получать около 1000 мг. (800 – 1250 мг в зависимости от массы тела).

суточная норма и продукты богатые кальцием

Последствия дефицита кальция в организме

По началу дефицит кальция не вызывает очевидных симптомов, потому что организм поддерживает уровень минерала, «заимствуя» его из костной ткани [2].

Симптомы серьезной кальциевой недостаточности (гипокальциемии) включают онемения и покалывания в пальцах, снижение аппетита, судороги, нарушения сердечного ритма, повышенную нервно-мышечную раздражительность [3].

Установлено, что ежедневное поступление кальция менее 400 мг сопровождается постепенной задержкой роста и снижением массы тела у школьников. У детей, получавших менее 250 мг кальция в день, отмечено значительное снижение роста и массы тела, а также плотности костной ткани [1].

Недостаток кальция способствует развитию остеопороза — заболевание, при котором происходит снижение прочности костной ткани, впоследствии чего увеличивается риск переломов костей [3].

Другим эффектом хронической недостаточности кальция является остеомаляция (патологическое размягчение костной ткани), которая может наблюдаться как у взрослых, так и у детей [3].

Ежедневная норма потребления кальция

Концентрация кальция в крови и внеклеточной жидкости должна поддерживаться в определенном диапазоне для нормального функционирования организма (2,3–2,8 ммоль/л) [1]. Физиологические функции кальция настолько важны, что при дефиците минерала организм будет вынужден стимулировать резорбцию костей (деминерализацию, т.е. разрушение) для поддержания нормальной концентрации кальция в организме.

В зависимости от пола и возраста рекомендуемая норма потребления кальция в сутки указана далее в миллиграммах (мг) [3], [5]:

  • У новорожденных в возрасте до 6 месяцев и в возрасте от 6 до 12 месяцев норма кальция в сутки составляет 200 и 260 мг;
  • У малышей в возрасте от 1 года до 3 лет и от 4 до 8 лет суточная норма кальция составляет 700 мг и 1000 мг соответственно;
  • Начиная с 9 лет до 18 норма кальция в день составляет 1300 мг;
  • Рекомендуемая суточная норма кальция для женщин в возрасте 19–50 лет составляет 1000 мг в день; для женщин старше 51 года — 1200 мг; для беременных и кормящих — 1000 мг.
  • Мужчинам в возрасте 19–70 лет рекомендуется ежедневно употреблять 1000 мг кальция; мужчинам старше 71 года – 1200 мг.

Хоть сбалансированная диета и способствует усвоению кальция, считается, что высокий уровень белка и соли в рационе увеличивает выведение кальция через почки. Следует избегать чрезмерного употребления этих веществ, особенно у людей с низким потреблением кальция [4].

Список продуктов богатых кальцием [3] [4]

Кальций поступает в организм из пищевых источников и пищевых добавок. Вы можете получить рекомендованную суточную норму кальция, употребляя следующие продукты:

  • Большое содержание кальция находится в молочных продуктах: молоко, йогурт, творог и сыр. Они обеспечивают 70–80% потребления кальция, что обусловлено не только его высоким содержанием, но и хорошим усвоением;
  • Капуста, брокколи, шпинат, репа являются прекрасными растительными источниками кальция;
  • Консервированные сардины и лосось;
  • Хлопья для завтрака, обогащенные кальцием, овсянка;
  • Фруктовые соки, особенно апельсиновый сок, обогащенный кальцием;
  • Миндаль.

Большинство специалистов рекомендуют получать как можно больше кальция ежедневно из пищевых продуктов, потому что кальций в продуктах питания сопровождается другими важными питательными веществами, которые участвуют в усвоении кальция организмом.

При дефиците кальция в организме врач может назначить витаминно-минеральные комплексы. Кальций в составе витаминно-минеральных комплексов важен для повышения прочности костной ткани.

Литература:
  1. Кожевникова Е.Н., Николаева С.В. Значение кальция в питании детей // Вопросы современной педиатрии. 2010. Том 9, №5: 95-98
  2. National Institutes of Health. Office of Dietary Supplements. Calcium Fact Sheet for Consumers. https://ods.od.nih.gov/pdf/factsheets/calcium-Consumer.pdf
  3. National Institutes of Health. Office of Dietary Supplements. Home. Health Information. Dietary Supplement Fast Sheets. Calcium. Health Professional. https://ods.od.nih.gov/factsheets/calcium-healthprofessional/
  4. National Institutes of Health. Osteoporosis And Related Bone Diseases National Resource Center. Calcium and Vitamin D: Important at Every Age. https://www.bones.nih.gov/health-info/bone/bone-health/nutrition/calcium-and-vitamin-d-important-every-age
  5. Harvard T.H. Chan. School of Public Health. Home. The Nutrition Source. Calcium. https://www.hsph.harvard.edu/nutritionsource/calcium/

! Данная информация не является заменой консультации специалистом. Необходимо обратиться к врачу. 

 

Какова норма кальция в крови человека?

Существует поговорка: «Лекарство купить можно, но здоровье ни за какие деньги не купишь». Мы многое готовы сделать, чтобы иметь его. Поэтому в последнее время на первый план выступает медицина профилактическая, а не лечебная. Чтобы вовремя предотвратить болезнь, необходимо периодически делать анализы, следить за показателями микроэлементов в организме, а также при малейших отклонениях обращаться к специалисту.

Важность содержания кальция в нашем организме

Кальций играет в организме значительную биологическую роль, поэтому важно знать, какая норма кальция в крови. Основные его задачи направлены на:

  • обмен железа;
  • поддержание сердечного ритма в норме и всей сердечно-сосудистой системы;
  • свертываемость крови, где активируется хорошая проницаемость в клеточных мембранах;
  • регуляция ферментативной активности;
  • нормализацию работы некоторых из эндокринных желез;
  • здоровье зубов;
  • прочность костей;
  • ритмичное сокращение мышц;
  • нормализацию работы центральной нервной системы ;
  • избавление от бессонницы.

Норма кальция в крови помогает человеку чувствовать себя активно, бодро и спокойно. Ведь он принимает участие во многих системах и органах.

В каких химических процессах организма задействован этот элемент?

Кальций — очень распространённый и жизненно необходимый элемент для человека. Особенно внимательно относятся к его содержанию в детском организме, ведь норма кальция в крови у малышей определяет их развитие. Основная масса кальция содержится в костях, являясь каркасом для нашего скелета и усиливая его, он также является базой для роста и развития зубов, входит в состав ногтей и волосяного покрова. Высокое содержание этого микроэлемента в костях обусловлено тем, что они для нас выполняю функцию резервуара.

Кальций незаменим, находится он почти в каждой клетке организма человека. Особенно большое количество его содержится в клетках нервов, мышц и сердца. Микроэлемент необходим для того, чтобы передавались нервные импульсы, и поэтому он содержится везде, где функционируют нейроны. К таким органам относится головной мозг, а также нервные клетки с окончаниями (аксонами и дендритами). Мышцы для нормализации своей работы также используют кальций.

Кальций в большой концентрации находится в крови, именно через нее он попадает в мышцы, кости или наоборот выходит из костей. Таким образом, он обеспечивает нормальную жизнедеятельность органов и организма в целом. Норма кальция в крови составляет 2,50 ммоль/л у взрослого человека.

Какие состояния указывают на проблемы с кальцием в организме?

При пониженном и повышенном уровне этого элемента в крови наблюдается ряд симптомов, проявляющихся по-разному.

При гипокальциемии (недостаточное количество кальция у человека) могут возникнуть некоторые патологические процессы, являющиеся зовом организма к обследованию и лечению.

Психическая симптоматика сопровождается:

  • головными болями, которые зачастую похожи на мигрень;
  • головокружением.

Со стороны кожи и костей гипокальциемия может проявляться:

  • при сухой коже с последующим появлением трещин;
  • при кариесе в зубах;
  • при поражении ногтевой пластинки;
  • при обильном выпадении волос;
  • при остеопорозе (нарушение плотности костей).

Нарушение нервно-мышечной системы характеризуется:

  • резкой слабостью;
  • тетаническими судорогами после чрезмерно усиленных рефлексов.

Расстройство деятельности сердечно-сосудистой системы влечет за собой:

  • длительную свертываемость крови;
  • учащение сердечных сокращений;
  • ишемическую болезнь сердца.

Состояния при гиперкальциемии несколько отличаются от предыдущих, это дает возможность врачу понять, что у больного кальций выше нормы в крови.

Нарушение ЦНС и мышц характеризуется:

  • головной болью;
  • потерей ориентации в пространстве;
  • рвотой, тошнотой;
  • общей слабостью организма;
  • резкой утомляемостью;
  • усилением интенсивности и количества рефлекторных действий;
  • в некоторых случаях неподвижностью.

Расстройство деятельности сердечно-сосудистой системы влечет за собой:

  • отложение кальция на стенках сосудов;
  • учащение и несвоевременность работы сердца;
  • недостаточность функций этого органа.

Также очень часто наблюдается отсутствие мочевыделения и, как следствие, почечная недостаточность.

Какие гормоны регулируют выработку кальция?

Выработку любых микроэлементов в человеческом организме регулируют специальные вещества, называемые гормонами. Содержание кальция в крови (норма которого в пределах 2,50 ммоль/л) также находится под их контролем.

Кальцитонин способствует регуляции метаболизма кальция. Вырабатывается он щитовидной железой, является одним из главных информаторов, определяющих наличие злокачественных новообразований в организме.

Остеокальцин, он появляется посредством формирования костных тканей специальными клеточными структурами.

Паратинин производит взаимообмен кальция. Выделяется он из клеток паращитовидной железы.

Кортизол — самый активный гормон глюкокортикоидов. Производит его кора надпочечников, он берет под свой контроль продуцирование других гормонов и абсолютно все процессы в организме, связанные с синтезом.

Альдостерон. Он осуществляет водно-солевой метаболизм: задерживает соли натрия, а соли калия из организма выводит.

Соматотропный гормон отвечает за рост. Производит регуляцию главным образом роста костной ткани, а также органов и мышц.

Функция адреногенитального гормона коры надпочечников направлена на поддержание состояния половых органов и на развитие отличительных признаков.

Кортикотропин вырабатывается из передней доли гипофиза. Он активирует выработку кортизола, регулирует появление гормонов и нормализует метаболизм.

Анализ для выявления количества этого элемента в крови

Судороги мышц, нервозность, длительная бессонница, а также заболевания, такие как кахексия, печеночная недостаточность, туберкулёз позвоночника являются прямыми показаниями к проведению этого анализа на кальций. Этот эффективный метод обследования позволяет врачам определить количество кальция и его содержание в крови. Кальций в анализе крови, норма которого всегда написана в результате, с точностью определяется только при соблюдении правил подготовки к исследованию. Проводят его утром (пищу не принимать за 8-12 часов), физические нагрузки на этот период исключают, алкоголь не употребляется. Если нет возможности сдать анализ утром, то забор крови производится после 6-часового голодания, при этом из утреннего приема пищи исключают жиры. Употребление молочных изделий, капусты и орехов строго запрещено, так как они являются основным источником кальция.

Норма кальция в крови взрослого и ребенка

У взрослого человека этот элемент занимает всего 1% от общего количества кальция во всех органах, тканях и системах. Поэтому уровень кальция в крови (норма его) составляет маленький диапазон, всего 2,15 — 2,50 ммоль/л. Отклонения от этих значений уже серьезно влияют на наш организм.

Показатели исследований взрослого человека отличаются от значений детских анализов. Не исключением является и анализ на содержание кальция в крови. Норма у новорожденных малышей составляет 1,75 ммоль/л, у детей первого месяца 2,2-2,5 ммоль/л. У подростков до 14 лет содержание этого элемента составляет 2,3-2,87 ммоль/л.

Отличие общего кальция от ионизированного

Общий кальций локализуется преимущественно в костной ткани. Он активно взаимодействует с ионами кровяной сыворотки. Главной задачей общего кальция является устранение его колебаний в сыворотке.

Ионизированный кальций никак не связан с белками, поэтому его еще называют свободным. Он, хоть и в меньших количествах находится в организме человека, но выполняет очень важные функции. Метаболизм, секреторную функцию, рост клеток, сокращение мышц и многое другое регулирует ионизированный кальций в крови. Норма этого элемента так же важна, как и общего.

Содержание общего кальция в костях приблизительно равно 99%. Содержится ионизированный кальций в крови (норма которого составляет 1%) только в сыворотке крови.

Гипокальциемия, причины

Если содержание кальция в крови (норма которого отмечена выше) значительно ниже положенного, нужно узнать причины такого состояния. Среди них часто встречаются следующие.

  1. Недостаточное содержание витамина D в организме.
  2. Минимальное поступление кальция с пищей.
  3. Патологические процессы, при которых происходит нарушение всасывания. К ним относятся резекция кишечника, недостаточность поджелудочной железы и частые поносы.
  4. Рахит.
  5. Онкологические заболевания.
  6. Хронический сепсис.
  7. Малая подвижность (гиподинамия).
  8. Аллергические реакции.
  9. Нарушение работы печени, обусловленное поражением токсинами (отравления после употребления алкоголя или воздействие продуктов тяжелых металлов).
  10. Приём лекарственных препаратов (интерлейкины или кортикостероиды).
  11. Повышенное содержание эстрогенов.

Если в жизни человека имеют место такие состояния, то можно сделать анализ, чтобы определить общий кальций в крови. Норма будет свидетельствовать о том, что органы и системы не затронуты патологическим процессом.

Как можно повысить содержание этого микроэлемента в организме

Для того чтобы была норма кальция в крови человека, необходимо осуществить некоторые действия. Во-первых, нужно обратиться к специалисту, так как вы сами не сможете определить причины такого отклонения. Во-вторых, если серьезных причин для пониженного кальция нет (сложных заболеваний или раковых опухолей), его уровень можно откорректировать питанием.

Основными продуктами, содержащими кальций, являются твердый сыр, творог, кунжут и его масло, яйца, молоко, кисломолочные продукты, зелень, орехи. В среднем человек должен потреблять от 800 до 1200 мг кальция в день.

Гиперкальциемия, почему она возникает

Если гипокальцемия легче поддается лечению, и человек быстрее восстанавливается, то состояние, при котором кальций значительно выше нормы, не всегда можно скорректировать. Это происходит потому, что причинами повышенного кальция являются серьезные заболевания, такие как:

  • сердечная недостаточность;
  • лейкоз;
  • пневмония;
  • болезнь Аддисона;
  • перитонит;
  • пневмония;
  • гепатит;
  • рак;
  • гипертиреоз.

Что нужно делать, чтобы уровень кальция не был высоким

Одним из действенных способов является употребление мягкой воды. Ее нужно пить не больше чем 2 месяца, так как вместе с кальцием могут выйти и другие важные элементы. Также применяется легкая терапия с помощью введения физиологического раствора в организм человека. Но при всем этом важно определиться с причинами повышенного уровня кальция, чтобы не пропустить серьезное заболевание.

Первичный гиперпаратиреоз с уровнем ПТГ в пределах референсных значений: случай поздней диагностики у пациентки с рецидивирующим течением мочекаменной болезни | Голоунина

АКТУАЛЬНОСТЬ

Гиперпаратиреоз – эндокринное заболевание, возникающее в результате автономной продукции паратиреоидного гормона (ПТГ), обусловленной первичным поражением околощитовидных желез (ОЩЖ) [1].

При первичном гиперпаратиреозе (ПГПТ) повышение секреции ПТГ происходит в результате аденомы либо гиперплазии одной или нескольких ОЩЖ. Поскольку ведущий биохимический признак ПГПТ – гиперкальциемия, при проведении диагностического поиска следует иметь в виду и другие, довольно многочисленные причины этого состояния.

Исследование уровня ПТГ необходимо проводить при выявлении отклонений от нормы содержания кальция и фосфора сыворотки крови, различных нарушений со стороны опорно-двигательного аппарата, хронической болезни почек (ХБП), рецидивирующей мочекаменной болезни, язвенной болезни желудка и двенадцатиперстной кишки, изменений состояния сердечно-сосудистой системы. В настоящее время ПТГ крови возможно исследовать различными высокочувствительными методами, но наиболее приемлемы те из них, в которых определяется интактный ПТГ (иПТГ), являющийся основным продуктом секреции клеток ОЩЖ.

Согласно клиническим рекомендациям по диагностике и лечению ПГПТ [1], верхненормальный либо повышенный уровень ПТГ в сочетании с гиперкальциемией позволяют диагностировать ПГПТ. В литературе встречаются единичные описания случаев сочетания гиперкальциемии с нормальной секрецией иПТГ. Представленный нами клинический случай демонстрирует один из редких вариантов течения ПГПТ.

ОПИСАНИЕ СЛУЧАЯ

Пациентка А., 64 лет, поступила в Клинику эндокринологии Первого МГМУ им. И.М. Сеченова (далее – Сеченовский Университет) с жалобами на выраженную общую и мышечную слабость, быструю утомляемость, постепенное снижение массы тела на 17 кг, давящие боли в области сердца, купирующиеся нитроглицерином, ощущение «онемения и покалывания» в руках и ногах.

Объективно: рост 156 см, вес 65 кг, ИМТ = 23,3 кг/м2. Наследственность не отягощена.

Из анамнеза известно, что в течение 28 лет страдает мочекаменной болезнью. За это время конкременты многократно отходили самостоятельно. Перенесла пиелолитотомию и нефропексию справа, уретеролитотомию слева, несколько эпизодов почечной колики. В 2017 г. в Клинике урологии Сеченовского Университета выполнены чрескожная нефролитолапаксия, нефростомия слева. Учитывая рецидивирующее течение мочекаменной болезни, проведен комплекс лабораторных исследований, данные которого представлены в таблице 1.

Таблица 1. Данные лабораторного исследования в Клинике урологии в мае 2017 г.

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,68

2,08–2,65

Кальций ионизированный, ммоль/л

1,46

1,12–1,32

Фосфор, ммоль/л

1,01

0,78–1,65

Щелочная фосфатаза, Ед/л

326

70–360

Паратгормон, пмоль/л

9,5

1,3–6,8

В возрасте 40 лет пациентке была выполнена субтотальная гистерэктомия по поводу миомы с удалением левого яичника. В 2010 г. диагностирована язвенная болезнь двенадцатиперстной кишки. С 2014 г. отмечает эпизоды повышения артериального давления до 180/100 мм рт.ст., в связи с чем регулярно принимает антигипертензивную терапию.

При поступлении в Клинику эндокринологии был заподозрен ПГПТ, проведены лабораторно-инструментальные исследования (табл. 2). При обследовании была выявлена гиперкальциемия (кальций общий 2,98 ммоль/л; кальций, скорректированный на альбумин, 3,03 ммоль/л), уровень ПТГ в пределах референсных значений. В клиническом анализе крови СОЭ увеличена до 39 мм/ч (по Панченкову), остальные показатели в пределах референсных значений.

В анализе суточной мочи отмечается гиперкальциурия (экскреция кальция 13,38 ммоль/сут), экскреция фосфора в пределах референсных значений.

Таблица 2. Показатели лабораторного исследования при первичном обращении

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,98

2,08–2,65

Кальций ионизированный, ммоль/л

1,65

1,12–1,32

Альбумин, г/л

37,4

32–48

Кальций, скорректированный на альбумин, ммоль/л

3,03

 

Фосфор, ммоль/л

1,10

0,78–1,65

Паратгормон интактный, пмоль/л

5,6

1,3–6,8

Тиреотропный гормон (ТТГ), мкМЕ/мл

0,7

0,4–4

Креатинин, мг/дл

1,02

0,5–1,3

Скорость клубочковой фильтрации (СКФ), мл/мин/1,73м2

58

90–120

25(ОН)D, нг/мл

30,7

>30

Учитывая нормальный уровень иПТГ, выполнено повторное исследование в лаборатории Клиники эндокринологии и в сторонней лаборатории. Также с целью исключения феномена hook-эффекта проведено исследование иПТГ с разведением. Полученные результаты представлены в таблице 3. В трех измерениях концентрация иПТГ превышает верхнюю границу референсного интервала, однако повышение незначимо и не соответствует выраженной гиперкальциемии и гиперкальциурии. Молекулярно-генетический анализ не выявил инактивирующей мутации в гене кальций-чувствительных рецепторов (CаSR) в почках и ОЩЖ. Употребление продуктов с высоким содержанием кальция, а также прием препаратов витамина D пациентка отрицала.

Таблица 3. Динамика иПТГ пациентки А.

иПТГ

Значение

Референсный интервал

При поступлении в стационар

9,5 пмоль/л

1,3–6,8

На 8-сутки госпитализации

5,6 пмоль/л

1,3–6,8

На 10-е сутки госпитализации

5,1 пмоль/л

1,3–6,8

На 16-е сутки госпитализации, сторонняя лаборатория

81,76 пг/мл

15–65

иПТГ с разведением

7,3 пмоль/л

1,3–6,8

иПТГ исследовался автоматической иммунохемилюминесцентной системой IMMULITE 2000 XPi.

При ультразвуковом исследовании (УЗИ) околощитовидные железы не визуализируются. Выявлены признаки диффузно-мелкоочаговых изменений щитовидной железы (ЩЖ). При сцинтиграфии с технетрилом (99mTс-MIBI) в сочетании с однофотонной эмиссионной компьютерной томографией (ОФЭКТ) обнаружен очаг аномального накопления умеренной интенсивности, расположенный за левой долей ЩЖ на уровне ее нижнего полюса, пространственно от нее сепарируемый, что указывает на признаки новообразования левой нижней ОЩЖ.

По результатам двухэнергетической рентгеновской абсорбциометрии (DXA) минеральная плотность костной ткани в проксимальном отделе бедренной кости по Т-критерию составила -1 SD, в поясничном отделе позвоночника (LI–LIV) – -3,0 SD.

На основании гиперкальциемии при нормальном иПТГ, повышения СОЭ в общем анализе крови, снижения массы тела в анамнезе проведены дополнительные обследования, позволившие исключить миеломную болезнь. Онкомаркеры, в том числе СА 19-9, СА-15-3, СА-125, раковоэмбриональный антиген, в пределах референсных значений.

Учитывая рецидивирующий нефролитиаз, нефрокальциноз, снижение СКФ до ХБП С3, язвенную болезнь в анамнезе, остеопороз по данным DXA, неоднократно подтвержденную гиперкальциемию, гиперкальциурию, несмотря на нормальный уровень иПТГ, диагностированы ПГПТ, смешанная форма, новообразование левой нижней ОЩЖ, ХБП С3, мочекаменная болезнь, язвенная болезнь двенадцатиперстной кишки в фазе ремиссии, остеопороз смешанного генеза с потерей минеральной плотности костной ткани до -3,0 SD по Т-критерию в поясничном отделе позвоночнике. Пациентке было рекомендовано хирургическое лечение – удаление новообразования левой нижней ОЩЖ.

26.10.2017 г. проведена селективная паратиреоидэктомия. В ходе операции при ревизии обнаружено и удалено образование размерами 1,0×0,6×0,5 см. При гистологическом исследовании послеоперационного материала верифицирована аденома из главных клеток ОЩЖ.

Послеоперационный период протекал без особенностей. В поликлинике по месту жительства 03.04.2018 г. пациентке была выполнена внутривенная инфузия золедроновой кислоты 5,0 мг. При динамическом наблюдении через год, по данным DXA, отмечается выраженная положительная динамика в виде повышения минеральной плотности костной ткани в поясничном отделе позвоночника (LI–LIV) до -2,0 SD по Т-критерию. По результатам лабораторных исследований наблюдается нормокальциемия, нормофосфатемия (табл. 4). Достижение ремиссии заболевания после хирургического лечения также имело положительное влияние на СКФ, которая увеличилась с 58 до 73 мл/мин/1,73 м2.

Таблица 4. Показатели фосфорно-кальциевого обмена после проведенного хирургического вмешательства от 20.02.2019 г.

Параметр

Значение

Референсный интервал

Кальций общий, ммоль/л

2,33

2,20–2,55

Альбумин, г/л

46

35–52

Кальций, скорректированный на альбумин, ммоль/л

2,21

 

Фосфор, ммоль/л

1,09

0,74–1,52

Паратгормон интактный, пмоль/л

6,18

1,6–6,9

Креатинин, мкмоль/л

75

50–98

Скорость клубочковой фильтрации (СКФ), мл/мин/1,73 м2

73

90–120

Кальций, суточная экскреция, ммоль/сут

7,47

2,50–7,50

Несмотря на отсутствие данных за рецидив заболевания, сохраняются жалобы на тупую боль в правой поясничной области. По данным УЗИ вновь выявлены камни в почках.

В настоящее время пациентка получает терапию нативным витамином D (колекальциферол 10 000 МЕ/нед). Рекомендовано достаточное потребление кальция с продуктами питания, динамическое наблюдение эндокринолога и уролога.

ОБСУЖДЕНИЕ

ПГПТ почти всегда является доброкачественным состоянием автономной активности ОЩЖ. Примерно в 80–85% случаев обнаруживается солитарная аденома одной из желез [2], в остальных, как правило, встречается диффузная гиперплазия и гиперфункция всех четырех ОЩЖ [3, 4], в том числе в рамках наследственных синдромов – синдрома множественных эндокринных неоплазий (МЭН 1, МЭН 2А, МЭН 4), синдрома гиперпаратиреоза с опухолью челюсти (hyperparathyroidism-jaw tumour syndrome, HPT-JT), семейной гипокальциурической гиперкальциемии (familial hypocalciuric syndrome, FHH), семейного изолированного гиперпаратиреоза (familial isolated hyperparathyroidism, FIHP) [5].

Гиперкальциемия – один из основных биохимических маркеров ПГПТ. В норме повышенное содержание кальция в крови улавливается кальций-чувствительными рецепторами, в результате чего подавляется секреция ПТГ, снижается всасывание кальция из ЖКТ, повышается его экскреция почками, усиливается минерализация костной ткани. Автономное избыточное образование ПТГ влечет за собой повышение концентрации кальция в сыворотке крови. По различным международным данным, частота встречаемости ПГПТ составляет 0,5–21 случая на 1000 населения [6]. Данные о распространенности ПГПТ с нормальным уровнем ПТГ варьируют от 5 до 20%. Mischis-Troussard C. и соавт. [7] провели оценку частоты встречаемости подобного феномена среди 271 пациента, прооперированного по поводу ПГПТ. В предоперационном периоде иПТГ в пределах референсных значений был выявлен у 20 пациентов (7,4%). Наиболее часто предъявлялись жалобы на быструю утомляемость (n=13), полиурию (n=6), артериальную гипертензию (n=5), у пятерых из 20 пациентов при УЗИ были диагностированы камни в почках. В российской научной литературе нет сведений о частоте встречаемости сочетания гиперкальциемии с нормальной секрецией иПТГ.

Pang C. и соавт. [8] в июле 2018 г. опубликовали описание похожего клинического случая. 54-летняя женщина с сахарным диабетом 2 типа, гиперкальциемией на протяжении двух лет (кальций общий 2,51–3,03 ммоль/л), пептической язвой желудка, сердечно-сосудистыми нарушениями, жалобами на общую слабость была госпитализирована с подозрением на ПГПТ. По результатам обследования подтверждена стойкая гиперкальциемия, однако повышение уровня ПТГ не было выявлено (ПТГ 21,95 пг/мл (норма 15–65 пг/мл)). Сцинтиграфия с 99mTс-MIBI в сочетании с ОФЭКТ позволила обнаружить очаг патологической гиперфиксации радиофармпрепарата правой верхней ОЩЖ. После проведенного хирургического лечения и гистологически подтвержденной аденомы ОЩЖ уровень кальция снизился до нормальных значений (2,34 ммоль/л), концентрация ПТГ составила 16,51 нг/мл.

Еще один подобный случай описан в педиатрической практике Benaderet A.D. и соавт. [9] у 14-летней девочки, страдавшей панкреатитом, нефролитиазом, тяжелой гиперкальциемией (уровень кальция в диапазоне 3,3–4,4 ммоль/л), но с низким уровнем интактного ПТГ. По данным УЗИ ОЩЖ – эхографические признаки объемного образования левой верхней ОЩЖ размером 1,1×0,8 см. Последующая сцинтиграфия с 99mTс-MIBI показала увеличение поглощения радиофармпрепарата левой верхней ОЩЖ, что соответствовало данным УЗИ. Дооперационные показатели иПТГ, определяемые методом иммуноферментного анализа (ИФА), были низкими даже после серийных разведений, тогда как интраоперационное экспресс-определение уровня иПТГ выявило его повышение до 3618 пг/мл. Маленькой пациентке провели анализ последовательности гена ПТГ с целью выявления возможной экспрессии аберрантной молекулы ПТГ, не обнаруживаемой рутинным анализом. Геномная ДНК была выделена из дезоксирибонуклеиновой кислоты (ДНК) паратиромы и лейкоцитов периферической крови и амплифицирована с помощью полимеразной цепной реакции (ПЦР) с праймером в интроне 1 (5’–CATTCTGTGTACTATAGTTTG–3’) и обратным праймером в интроне 3 (5’–GAGCTTTGAATTAGCAGCATG–3’). Выявлена «молчащая» мутация в кодоне 83, кодирующем аргинин, что является распространенным генетическим полиморфизмом и не влияет на аминокислотную последовательность белка.

ПТГ синтезируется в ОЩЖ в виде молекулы-предшественника – пре-про-ПТГ, содержащей 115 аминокислотных остатков. В процессе переноса в эндоплазматический ретикулум отщепляется сигнальный пептид из 25 аминокислот от аминотерминального конца. Образующийся про-ПТГ транспортируется в аппарат Гольджи, где происходит ферментативное отщепление 6 аминокислот от аминотерминального конца про-ПТГ и образуется зрелый ПТГ, включающий 84 аминокислотных остатка (ПТГ 1-84) [10]. Известно, что кальций воздействует на процессы синтеза и секреции ПТГ через CaSR, а также влияет на стабильность мРНК пре-про-ПТГ [11, 12]. Учитывая отсутствие изменений в последовательности гена ПТГ, можно предположить о посттрансляционных изменениях молекулы ПТГ в нашем и вышеописанном клинических случаях, которые не могут быть распознаны только секвенированием ДНК.

На сегодняшний день большинство используемых методов определения ПТГ направлено на интактную молекулу (ПТГ 1-84). Применяемые иммунорадиометрический и иммунохемилюминесцентный анализы с антителами к N- и С-концам молекулы позволяют определить концентрацию иПТГ. Метаболизм ПТГ 1–84 происходит в печени (60–70%) с расщеплением между 33 и 36 аминокислотами и образованием биологически активных N-терминальных фрагментов (первые 34 аминокислоты). Однако в идеале специфичному лабораторному анализу должна подвергаться целая молекула ПТГ 1–84.

Принимая во внимание многообразие проявлений клинической картины ПГПТ, актуальной остается проблема ранней диагностики и своевременного лечения подобных больных. Выявленные при целенаправленном исследовании гиперкальциемия и незначительно повышенный иПТГ у пациентки с рецидивирующим течением мочекаменной болезни, выраженным снижением минеральной плотности костной ткани по данным DXA, язвенной болезнью в анамнезе позволили заподозрить ПГПТ. В то же время значительное снижение массы тела, повышение уровня СОЭ потребовали дополнительного диагностического поиска для исключения паранеопластического процесса, несмотря на отсутствие подавления ПТГ. Окончательный диагноз должен основываться на совокупности не только лабораторных данных, но и клинических признаков с учетом сопутствующих патологий и выраженности клинических проявлений гиперкальциемии.

ЗАКЛЮЧЕНИЕ

Представленный клинический случай демонстрирует важность исключения ПГПТ как причины рецидивирующего нефролитиаза и нефрокальциноза. Определение общего кальция, альбумина, сывороточного уровня ПТГ у больных, имеющих клиническую картину ПГПТ, позволит своевременно диагностировать заболевание и значительно улучшить качество жизни пациентов.

ДОПОЛНИТЕЛЬНАЯ ИНФОРМАЦИЯ

Источник финансирования. Подготовка и публикация рукописи проведены на личные средства авторского коллектива.

Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Участие авторов. Все авторы внесли значимый вклад в проведение исследования и подготовку статьи, прочли и одобрили финальную версию статьи перед публикацией.

Согласие пациента. Пациентка добровольно подписала информированное согласие на публикацию персональной медицинской информации в обезличенной форме в журнале «Ожирение и метаболизм».

1. Мокрышева Н.Г., Рожинская Л.Я., Кузнецов Н.С., и др. Клинические рекомендации Первичный гиперпаратиреоз: клиника, диагностика, дифференциальная диагностика, методы лечения // Проблемы эндокринологии. – 2016. – Т. 62. – №6. – С. 40-77. [Dedov II, Melnichenko GA, Mokrysheva NG, et al. Primary hyperparathyroidism: the clinical picture, diagnostics, differential diagnostics, and methods of treatment. Problems of Endocrinology. 2017;62(6):40-77. (In Russ).] DOI:10.14341/probl201662640-77

2. Bilezikian JP. Primary Hyperparathyroidism. J Clin Endocrinol Metab. 2018;103(11):3993-4004. DOI:10.1210/jc.2018-01225

3. Bilezikian JP, Bandeira L, Khan A, Cusano NE. Hyperparathyroidism. Lancet. 2018;391(10116):168-178. DOI:10.1016/S0140-6736(17)31430-7

4. Bilezikian JP, Cusano NE, Khan AA, et al. Primary hyperparathyroidism. Nat Rev Dis Prim. 2016;2(1):16033. DOI:10.1038/nrdp.2016.33

5. Thakker R V. Genetics of parathyroid tumours. J Intern Med. 2016;280(6):574-583. DOI:10.1111/joim.12523

6. Adami S, Marcocci C, Gatti D. Epidemiology of primary hyperparathyroidism in Europe. J Bone Miner Res. 2002;17 Suppl 2(6):N18-23. PMID: 12412773

7. Mischis-Troussard C. Primary hyperparathyroidism with normal serum intact parathyroid hormone levels. QJM. 2000;93(6):365-367. DOI:10.1093/qjmed/93.6.365

8. Pang C, Fan Y, Zhang H, et al. Case report: incidental parathyroid adenoma in a Chinese diabetic patient with hypercalcemia and normal parathyroid hormone levels. Medicine (Baltimore). 2018;97(28):e11333. DOI:10.1097/MD.0000000000011333

9. Benaderet AD, Burton AM, Clifton-Bligh R, Ashraf AP. Primary Hyperparathyroidism with Low Intact PTH Levels in a 14-Year-Old Girl. J Clin Endocrinol Metab. 2011;96(8):2325-2329. DOI:10.1210/jc.2011-0247

10. Goltzman D. Physiology of Parathyroid Hormone. Endocrinol Metab Clin North Am. 2018;47(4):743-758. DOI:10.1016/j.ecl.2018.07.003

11. Brown EM. Physiology and pathophysiology of the extracellular calcium-sensing receptor. Am J Med. 1999;106(2):238-253. DOI:10.1016/S0002-9343(98)00418-5

12. Moallem E, Kilav R, Silver J, Naveh-Many T. RNA-Protein Binding and Post-transcriptional Regulation of Parathyroid Hormone Gene Expression by Calcium and Phosphate. J Biol Chem. 1998;273(9):5253-5259. DOI:10.1074/jbc.273.9.5253


Гиперкальциемия — диагностика и лечение в медицинском центре «Андреевские больницы

Гиперкальциемия — это состояние, обусловленное повышением содержания кальции в крови более 2,6 ммоль/л. Зачастую патология протекает бессимптомно, но все же некоторые особенности состояния есть.

Учитывая, что первым симптомом патологии является запор, мало у кого возникает подозрение, что данное состояние связано именно с избытком кальция, и только анализ крови позволяет определить отклонения.

Причины гиперкальциемии

Гиперкальциемия может сформироваться по различным причинам. В первую очередь следует отметить гиперпаратиреоз. При данном заболевании возникает повышенная выработка паратгормона. Патология чаще диагностируется у женщин старше 40 лет.

Помимо этого, данное состояние может быть вызвано употреблением большого количества кальцийсодержащих препаратов, а также нарушением, а точнее, избыточным всасыванием кальция в желудочно-кишечном тракте. Следует отметить, что чрезмерное употребление витамина D также может привести к повышенной усвояемости кальция и, как следствие, гиперкальциемии.

В некоторых случаях заболевание диагностируется на фоне онкологических патологий, таких как рак почек, легких, яичников и так далее. Кроме того, онкологическое поражение костей ведет к разрушению тканей и, как следствие, выделению кальция в кровь.

Также нелишним будет отметить, что гиперкальциемия может развиться при таких заболеваниях, как болезнь Педжета, параличах и как последствие длительного постельного режима, связанного с какой-либо патологией.

Симптомы гиперкальциемии

Гиперкальциемия чаще всего протекает без каких-либо симптомов. В результате этого патология диагностируется во время проведения различных анализов. Первым симптомом избытка кальция в крови является запор. Присоединяются нарушения аппетита, рвота, тошнота, а также болевые ощущения в животе неясной этиологии. Одновременно с этим появляется повышенная выработка мочи, что грозит обезвоживанием организма. При прогрессировании заболевания и при отсутствии лечения могут появиться симптомы нарушения функции мозга в виде потери сознания, бреда, выраженной слабости и даже комы. Кроме того, нарушение сердечного ритма может привести к смертельному исходу.

При длительной гиперкальциемии образуются камни в почках с содержанием в них кальция. Большое количество кристаллов кальция повышает риск необратимых изменений почек и, как следствие, почечной недостаточности.

Диагностика гиперкальциемии

Определить гиперкальциемию достаточно просто. Для этого следует лишь сдать анализ крови на электролиты. Превышение нормы, которая составляет 2,1-2,55 ммоль/л, является доказательством наличия патологии.

Лечение гиперкальциемии

Для того чтобы избавиться от гиперкальциемии, следует определить причину и степень превышения нормы. При уровне кальция в 2,9 ммоль/л достаточно увеличить объемы употребляемой жидкости. При этом важно исключить патологию почек, так как повышенная нагрузка на них может усугубить ситуацию.

При появлении признаков поражения мозга следует провести экстренные мероприятия. Наиболее часто в данных ситуациях проводят внутривенное вливание жидкостей, а также диуретиков для улучшения выведения кальция из организма.

В том случае, когда гиперкальциемия вызвана гиперпаратиреозом, проводится операция по удалению пораженной доли. То же касается состояний, вызванных злокачественными образованиями других органов.

Профилактика гиперкальциемии

Избежать гиперкальциемии вам поможет регулярный контроль уровнять кальция в крови. Особенно это касается больных с заболеваниями эндокринной системы, онкологическими патологиями почек, печени и яичников. Все препараты, содержащие витамин D и кальций, должны приниматься под контролем врача.

Нормальные диапазоны кальция в крови в зависимости от возраста.

Каков нормальный уровень кальция в крови?

Уровни кальция в крови различаются в зависимости от вашего возраста: у детей, подростков и молодых людей уровень кальция выше, чем у взрослых старше 30 или 35 лет. Роль паращитовидных желез заключается в поддержании уровня кальция в крови в нормальном диапазоне. Этот небольшой нормальный диапазон содержания кальция в крови различен для разных возрастов , как показано на графике ниже.Зеленая область на этом графике показывает, как нормальный диапазон содержания кальция в крови меняется в течение жизни. Нижняя ось X — это наш возраст в годах, а вертикальная ось Y — количество кальция в крови. Обратите внимание, как резко увеличивается содержание кальция в крови, когда мы подростки и у нас растут кости (и мы становимся выше). В возрасте 26 лет наши кости самые крепкие и плотные (в них содержится больше всего кальция), и с этого момента гормональные изменения в нашем организме вызывают снижение количества кальция в крови.К 35 годам уровень кальция в большинстве случаев должен быть ниже 10,2 мг/дл. Когда нам за 40, уровень кальция не должен превышать 10,0 или 10,1. Почти все люди старше 40 лет имеют уровень кальция «на уровне 9». Если вы находитесь в Европе и Канаде, верхний предел нормального уровня кальция составляет 2,5 ммоль/л.


Вот БОЛЬШАЯ ПРОБЛЕМА…
Большинство лабораторий, которые измеряют содержание кальция в крови, НЕ делают поправку на ваш возраст или используют слишком большие диапазоны содержания кальция.

Одна из самых распространенных ошибок, которую мы наблюдаем при ежегодном обследовании тысяч пациентов на гиперпаратиреоз и высокое содержание кальция в крови, заключается в том, что врачи не знают, что лаборатория не дает «нормального диапазона» в соответствии с возрастом пациента. Вместо этого лаборатория часто дает нормальный диапазон для «всех людей», и этот нормальный диапазон достигает 10,5 или даже 10,7 мг/дл. Ну, технически лаборатория правильная, это диапазон для всех людей, но если пациенту 55 лет, то верхний предел нормы в лабораториях этого пациента должен быть 10.0 мг/дл. Лаборатория не дает нормальный диапазон содержания кальция в крови для ВАС, она дает нормальный диапазон для всех людей всех возрастов.

Мы видим пациентов старше 40 лет каждый день , у которых уровень кальция в крови выше 10,0 мг/дл в течение лет , но они считают это нормальным, потому что лаборатория говорит, что нормально иметь кальций до 10,6. Это неправильно! Уровень кальция в крови от 10,2 до 10,5 у человека старше 40 лет указывает на опухоль паращитовидной железы, пока не доказано обратное.




Уровень кальция в крови выше нормы может вызвать проблемы.

Следующий график идет еще дальше и очень четко показывает, что пациенты с гиперпаратиреозом имеют высокий уровень кальция в крови, что показано синим цветом. Обратите внимание, что диагностика гиперпаратиреоза у человека в возрасте 18 лет сильно отличается от диагностики у человека в возрасте 65 лет. У нормального, здорового подростка уровень кальция в крови выше 10,0, и большую часть времени у этих здоровых нормальных подростков уровень кальция находится между 10.0 и 10,7 мг/дл. Однако у пациента в возрасте 60 лет уровень кальция должен быть «на уровне 9». Уровень кальция 10,5 является нормальным для человека 21 года, но сигнализирует о наличии опухоли паращитовидной железы у взрослого человека старше 40 лет.

Подростки с гиперпаратиреозом обычно имеют уровень кальция в крови от 10,9 до 12,3 — это не тонко. Однако у взрослых старше 40 лет частые или постоянные уровни кальция выше 10,2 почти всегда указывают на опухоль паращитовидной железы.Один момент здесь … синяя область начинается примерно в возрасте 10 лет, потому что гиперпаратиреоз настолько редко встречается в возрасте до 10 лет, что его практически не существует. Помните, что люди старше 10 лет могут заболеть опухолью паращитовидной железы, но пик заболеваемости приходится на возраст от 50 до 80 лет. Подробнее об этом читайте на нашей странице о возрасте. (Примечание: около 2% людей с гиперпаратиреозом могут иметь уровни кальция в зеленой области, не «все» пациенты с гиперпаратиреозом имеют высокий уровень кальция в крови).


У большинства взрослых с гиперпаратиреозом уровень кальция в крови повышен лишь незначительно.

Третий и последний график в этой серии показывает, что у 75% людей с первичным гиперпаратиреозом (и, следовательно, с опухолью паращитовидной железы на шее) уровень кальция в крови незначительно повышен. На других страницах этого веб-сайта есть другие графики, которые показывают средний уровень содержания кальция и ПТГ в крови для наших последних 20 000 пациентов, но здесь мы можем легко показать, что большинство опухолей паращитовидной железы лишь незначительно увеличивают содержание кальция в крови, что показано фиолетовой областью. Таким образом, у большинства взрослых с гиперпаратиреозом уровень кальция «на уровне 10».Помните, что у взрослых старше 40 лет уровень кальция должен быть «на уровне 9».

Теперь вы видите самую большую проблему, с которой мы сталкиваемся… у большинства людей с опухолью паращитовидной железы уровень кальция повышен лишь незначительно или умеренно, и лаборатория не дает нормальных диапазонов, характерных для возраста пациента. Каждый день мы видим пациентов с опухолями паращитовидной железы, у которых никогда не было уровня кальция, выходящего за пределы допустимого диапазона, поскольку указанный диапазон был неправильным.


Уровень кальция в крови является очень плохим показателем тяжести гиперпаратиреоза.

Во многих сферах жизни и во многих областях медицины, если уж на то пошло, большее число имеет большее значение, чем меньшее.Например, уровень холестерина 350 «хуже», чем уровень холестерина 310. Уровень кальция в крови является большим исключением из этого правила. Человек с «тяжелым» гиперпаратиреозом — это тот, у кого САМОЕ ДЛИТЕЛЬНОЕ наблюдается высокое содержание кальция в крови, а не тот, у кого САМОЕ ВЫСОКОЕ содержание кальция.

Вот почему мы не рекомендуем «наблюдать» или «контролировать» ваш слегка повышенный уровень кальция, чтобы увидеть, повышается ли он. Во-первых, неважно, насколько она высока! «Слегка» высокий уровень кальция в течение ряда лет может вызвать серьезные проблемы со здоровьем (подробно обсуждается в другом месте).Во-вторых, мы знаем, что происходит, когда болезнь паращитовидной железы не лечат. Уровень кальция может никогда не попасть в «чрезвычайно высокий» диапазон, но со временем риск осложнений от болезни (включая остеопороз, камни в почках, болезни почек, сердечные аритмии, хроническую усталость, потерю памяти, бессонницу и многое другое) возрастает. То, насколько высоким стал уровень кальция, является очень плохим показателем тяжести первичного гиперпаратиреоза.

Уровень кальция в крови 11,5 НЕ более опасен, чем уровень кальция в крови 10.5.

Таким образом, нормальный уровень кальция меняется с возрастом. Ваше тело хочет, чтобы ваш кальций оставался в строгом диапазоне, и за это отвечают паращитовидные железы. Для подростков и молодых людей нормально иметь уровень кальция от среднего до высокого уровня 10 (в мг/дл). Для взрослых старше 40 лет уровень кальция обычно должен находиться в диапазоне от 9,3 до 9,9 мг/дл. Высокий уровень кальция почти всегда указывает на заболевание паращитовидной железы.



Последнее обновление этой страницы: 12.04.2021

Кальций (Ca) в анализе крови

Обзор испытаний

Тест на кальций в крови проверяет уровень кальция в организме, который не хранится в костях.Кальций является наиболее распространенным минералом в организме и одним из самых важных. Организм нуждается в нем, чтобы строить и фиксировать кости и зубы, помогать работе нервов, заставлять мышцы сжиматься, помогать свертываться крови и помогать сердцу работать. Почти весь кальций в организме хранится в костях.

В норме уровень кальция в крови тщательно контролируется. Когда уровень кальция в крови становится низким (гипокальциемия), кости высвобождают кальций, чтобы вернуть его к хорошему уровню в крови. Когда уровень кальция в крови становится высоким (гиперкальциемия), лишний кальций откладывается в костях или выводится из организма с мочой и стулом.Количество кальция в организме зависит от количества:

Витамин D и эти гормоны помогают контролировать количество кальция в организме. Они также контролируют количество кальция, которое вы усваиваете из пищи, и его количество, выводимое из организма с мочой. Уровни фосфатов в крови тесно связаны с уровнями кальция, и они работают противоположным образом: когда уровень кальция в крови становится высоким, уровень фосфатов снижается, и обратное также верно.

Важно получать с пищей нужное количество кальция, потому что организм теряет кальций каждый день.К продуктам, богатым кальцием, относятся молочные продукты (молоко, сыр), яйца, рыба, зеленые овощи и фрукты. Большинство людей с низким или высоким уровнем кальция не имеют никаких симптомов. Уровень кальция должен быть очень высоким или низким, чтобы вызвать симптомы.

Почему это делается

Анализ крови на кальций можно сделать:

  • Для выявления проблем с паращитовидными железами или почками, некоторых видов рака и проблем с костями или воспаления поджелудочной железы (панкреатита).
  • Чтобы найти причину отклонений от нормы на электрокардиограмме (ЭКГ).
  • После пересадки почки.
  • Чтобы выяснить, не вызваны ли ваши симптомы очень низким уровнем кальция в крови. Такие симптомы могут включать мышечные спазмы, спазмы, подергивания и покалывание в пальцах и вокруг рта.
  • Чтобы узнать, не вызваны ли ваши симптомы очень высоким уровнем кальция в крови. Такие симптомы могут включать слабость, упадок сил, отсутствие желания есть, тошноту и рвоту, запор, обильное мочеиспускание, боль в животе или боль в костях.
  • Как часть обычного анализа крови.

Анализ крови на кальций нельзя использовать для проверки недостатка кальция в рационе или потери кальция из костей (остеопороза). Организм может иметь нормальный уровень кальция, даже если в вашем рационе недостаточно кальция. Другие тесты, такие как плотность костей, проверяют количество кальция в костях.

Как подготовить

  • Не принимайте добавки с кальцием за 8–12 часов до исследования.
  • Ваш врач сообщит вам, не следует ли вам ничего есть или пить перед исследованием.

Как это делается

Медицинский работник использует иглу для взятия образца крови, обычно из руки.

Часы

Каково это

При взятии образца крови вы можете вообще ничего не почувствовать от иглы. Или вы можете почувствовать быстрое жало или щепотку.

Риски

Вероятность возникновения проблемы с этим тестом очень мала.При заборе крови на месте может образоваться небольшой синяк.

Результаты

Обычный

Каждая лаборатория имеет свой диапазон нормы. В вашем лабораторном отчете должен быть указан диапазон, который ваша лаборатория использует для каждого теста. Нормальный диапазон — это всего лишь ориентир. Ваш врач также рассмотрит ваши результаты в зависимости от вашего возраста, состояния здоровья и других факторов. Значение, которое не находится в нормальном диапазоне, может быть нормальным для вас.

Нормальные значения кальция в крови ниже у пожилых людей.

У вас также могут быть значения теста на ионизированный кальций. Этот тест проверяет количество кальция, не связанного с белком в крови. Уровень ионизированного кальция в крови не зависит от количества белка в крови.

Высокие значения

Высокие значения кальция могут быть вызваны:

Низкие значения

Низкие значения кальция могут быть вызваны:

Кредиты

Актуально на: 23 сентября 2020 г.

Автор: Healthwise Staff
Медицинский обзор:
E.Грегори Томпсон, доктор медицинских наук, внутренние болезни
Адам Хасни, доктор медицинских наук, семейная медицина
Мартин Дж. Габика, доктор медицинских наук, семейная медицина

Актуально на: 23 сентября 2020 г.

Автор: Здоровый персонал

Медицинское обозрение: E. Грегори Томпсон, доктор медицинских наук, внутренние болезни, и Адам Хасни, доктор медицинских наук, семейная медицина, и Мартин Дж. Габика, доктор медицинских наук, семейная медицина

.

Кальций в крови в норме и факторы, влияющие на баланс кальция

Кальций является наиболее распространенным минералом в организме.Он необходим для здоровья костей, но он также необходим для правильного функционирования наших нервов и мышц. Читайте дальше, чтобы узнать больше о тестировании кальция и о том, какие важные факторы влияют на уровень кальция в организме. Мы также обсудим распространенную, но часто упускаемую из виду причину высокого уровня кальция.

Почему важен кальций?

Кальций является наиболее распространенным минералом в организме человека. Он выполняет множество важных функций, в том числе [1]:

  • Сохраняет прочность наших костей и зубов
  • Участвует в функционировании нервов и мышц
  • Участвует в свертывании крови тела в наших костях и зубах.Оставшийся 1% кальция циркулирует в крови [1].

    Анализ крови на кальций

    Анализ на кальций измеряет уровень кальция в крови. Чаще всего тест оценивает 90 179 общих уровней кальция 90 180 , которые включают [2, 3, 4]: 10%)

  • Ионизированный кальций, также известный как свободный или активный кальций (около 45–50%)

Вам не нужно заранее готовиться к этому тесту или голодать.Медицинский работник просто возьмет образец крови из вашей вены, который будет проанализирован.

Ваш врач может также заказать тест на ионизированный (бесплатный) кальций .

Ионизированный кальций является активной формой кальция в организме. Предполагается, что он составляет около 45-50% от общего количества кальция в крови, хотя точный процент может варьироваться. Уровни ионизированного кальция часто являются лишь оценкой, основанной на общем уровне кальция и альбумина в крови. Тестирование ионизированного кальция намного точнее, но требует специального оборудования и дороже, чем [2].

Как это используется

Анализ крови на кальций часто проводится как часть обычной метаболической панели. Базовая метаболическая панель (BMP) проверяет уровень сахара в крови, кальций и электролиты, а также функцию почек. Комплексная метаболическая панель (CMP) также включает уровни белка и маркеры функции печени [5].

Ваш врач может назначить анализ кальция, если у вас есть:

  • Симптомы очень высокого или очень низкого уровня кальция
  • Болезнь почек (включая камни в почках) Нормальный диапазон

    Нормальный диапазон для общего кальция у взрослых составляет около 8.5–10,5 мг/дл 90–180 или 2,12–2,62 ммоль/л. Эти значения могут немного отличаться от лаборатории к лаборатории, в зависимости от методов, оборудования и используемых химических веществ [1, 6].

    Гипокальциемия («гипо» = низкий уровень, «кальциемия» = кальций в крови) — это когда уровень кальция в крови падает ниже 8,5 мг/дл. Подробнее о симптомах и причинах гипокальциемии вы можете прочитать в наших постах о дефиците кальция.

    Гиперкальциемия («гипер» = высокая, «кальциемия» = кальций в крови) — это когда уровень кальция в крови превышает 10.5 мг/дл. Здесь мы подробно описываем все причины высокого содержания кальция в крови. Однако одна причина часто остается незамеченной, особенно у пожилых людей: гиперпаратиреоз (подробнее см. ниже).

    Факторы, влияющие на уровень кальция

    Минералы и гормоны

    Уровень кальция в крови зависит от нескольких важных факторов, включая [6]:

    ПТГ

    Уровень кальция в крови в основном контролируется паратгормоном (ПТГ). Клетки паращитовидной железы, расположенной на шее сразу за щитовидной железой, выделяют ПТГ, когда ощущают падение уровня кальция в крови [7].

    ПТГ повышает уровень кальция в крови за счет увеличения всасывания кальция из кишечника и почек. Этот гормон также может мобилизовать кальций и фосфат из костей: то есть он может расщеплять и высвобождать минеральное содержимое костей, чтобы компенсировать низкий уровень кальция. Этот процесс известен как резорбция кости [7].

    Витамин D

    ПТГ также увеличивает количество витамина D, который преобразуется в его активную форму, кальцитриол. Активный витамин D увеличивает всасывание кальция в кишечнике и ограничивает потерю кальция через почки [7].

    Фосфор

    Фосфор связывается с кальцием. Когда уровень фосфора в крови повышается, уровень кальция имеет тенденцию к снижению. И наоборот, если фосфор истощается, уровень кальция повышается. Иногда это может привести к гиперкальциемии (высокому содержанию кальция) [6].

    Магний

    И последнее, но не менее важное: уровень кальция зависит от магния. Когда уровень магния в норме, кальций не изменяется. Но если уровень магния низкий, он может подавлять выработку паратиреоидного гормона (ПТГ). Это приводит к снижению уровня кальция.Поэтому дефицит магния может быть причиной гипокальциемии (дефицита кальция) [6].

    Гиперпаратиреоз: недостаточно диагностированное состояние?

    Гиперпаратиреоз или сверхактивная паращитовидная железа является наиболее частой причиной гиперкальциемии (высокого содержания кальция). Это состояние может быть вызвано увеличением одной или нескольких паращитовидных желез (доброкачественными или из-за рака) [8, 9].

    Некоторые исследования показывают, что гиперпаратиреоз часто может оставаться незамеченным. Согласно одному исследованию, например, повышенный уровень кальция не учитывался или игнорировался в 58% случаев .Даже когда и кальций, и ПТГ были выше нормы, в 28% случаев диагноз не ставился. Высокий уровень кальция в крови часто может быть ошибочно приписан другим причинам, таким как диуретики, добавки кальция, обезвоживание и нарушение функции почек [10, 11].

    Симптомы

    Общие симптомы гиперпаратиреоза включают [12, 13, 14, 15]:

    • камни
    • Muscle слабость
    • медленное пищеварение
    • высокое кровяное давление и другие проблемы сердца
    • хрупкие кости и частые переломы костей (особенно у женщин в постменопаузе)
    • Нарушение когнитивных функций
    • Депрессия
    • Тревога

    Если вам больше 60 лет и вы испытываете симптомы гиперпаратиреоза, обратитесь к врачу, чтобы выяснить, что его вызывает, и устранить любые сопутствующие заболевания. .Возможно, вам потребуется обратиться к эндокринологу для дальнейшего обследования паращитовидной железы и обсуждения результатов лабораторных исследований [10].

    Еда на вынос

    Кальций крови является важным тестом, который может помочь вашему врачу диагностировать такие проблемы, как заболевания костей, почек, щитовидной железы и паращитовидных желез. Важными факторами, влияющими на уровень кальция, являются уровни паратгормона (ПТГ), витамина D, фосфора и магния.

    Гиперпаратиреоз — часто упускаемая из виду причина высокого уровня кальция, особенно у пожилых людей.Квалифицированные эндокринологи знают, как распознать и лечить это заболевание.

    Гипопаратиреоз — NHS

    Гипопаратиреоз — это редкое заболевание, при котором паращитовидные железы, расположенные на шее рядом с щитовидной железой, вырабатывают слишком мало паратиреоидного гормона.

    Это вызывает падение уровня кальция в крови (гипокальциемия) и повышение уровня фосфора в крови (гиперфосфатемия), что может вызывать широкий спектр симптомов, включая мышечные спазмы, боль и подергивание.

    Лечение гипопаратиреоза включает прием пищевых добавок, обычно пожизненный, для восстановления уровня кальция и фосфора.

    Симптомы гипопаратиреоза

    Симптомы гипопаратиреоза могут включать:

    • ощущение покалывания (парестезии) в кончиках пальцев рук и ног и губ
    • подергивание мышц лица
    • мышечные боли или судороги, особенно в ногах, ступнях или животе
    • усталость
    • изменения, такие как чувство раздражительности, беспокойства или депрессии
    • сухая, грубая кожа
    • жесткие волосы, которые легко ломаются и могут выпадать
    • ногти, которые легко ломаются

    Диагностика гипопаратиреоза

    Гипопаратиреоз диагностируется после того, как анализ крови показал:

    • низкий уровень паратиреоидного гормона
    • низкий уровень кальция
    • высокий уровень фосфора

    Лечение гипопаратиреоза

    Лечение гипопаратиреоза направлено на облегчение симптомов и возвращение к норме уровня кальция и других минералов в крови.

    Нормальный диапазон содержания кальция составляет от 2,2 до 2,6 миллимолей на литр (ммоль/л). Вам будет рекомендовано поддерживать уровень кальция в несколько более низком диапазоне, например, от 1,8 до 2,25 ммоль/л. Ваш рекомендуемый диапазон будет зависеть от ваших обстоятельств.

    Добавки с карбонатом кальция и витамином D — обычно кальцитриол (Rocaltrol) или альфакальцидол (One-Alpha) — можно принимать для восстановления содержания кальция в крови до этих уровней. Их обычно приходится принимать пожизненно.

    Вам также необходимо регулярно сдавать анализы крови для контроля уровня паратиреоидного гормона, кальция и фосфора.

    Если уровень кальция в крови падает до опасно низкого уровня или у вас продолжаются мышечные спазмы, вам может потребоваться введение кальция через капельницу прямо в вену.

    Рекомендации по диете

    Также рекомендуется соблюдать диету с высоким содержанием кальция и низким содержанием фосфора.

    Хорошие источники кальция включают:

    • молоко, сыр и другие молочные продукты
    • листовые зеленые овощи, такие как брокколи, капуста и бамия, но не шпинат
    • соевые бобы
    • тофу
    • соевые напитки с добавлением кальция 9
    • гайки
    • Хлеб и что-то, что сделано с укрепленной мукой
    • рыба, где вы едите кости, такие как сардины и Pilchards

    Phosphorus находятся в:

    • красное мясо
    • Dairy
    • рыба
    • птица
    • хлеб
    • рис
    • овес

    Причины гипопаратиреоза

    Наиболее частой причиной гипопаратиреоза является удаление или случайное повреждение паращитовидных желез во время операции на шее.

    Другие причины включают:

    • аутоиммунные состояния, при которых организм ошибочно атакует собственные ткани, такие как болезнь Аддисона и пернициозная анемия
    • рождение без паращитовидных желез или с железами, которые не работают должным образом, наследственное генетическое заболевание синдром Ди Джорджи может иметь недоразвитие паращитовидных желез
    • лучевая терапия для лечения рака горла или шеи
    • низкий уровень магния в крови – например, из-за злоупотребления алкоголем

    Последняя проверка страницы: 01 апреля 2021 г.
    Дата следующей проверки: 01 апреля 2024 г.

    Что такое гиперкальциемия? | Детская больница Филадельфии

    Гиперкальциемия относится к аномально высокой концентрации кальция в крови.Кальций циркулирует в кровотоке и необходим организму для здоровья костей и многих других процессов. Правильный уровень кальция обеспечивает оптимальную работу нервов, мышц, пищеварительного тракта, почек и даже сердца.

    Уровень кальция в крови обычно контролируется витамином D и гормонами, такими как паратиреоидный гормон (ПТГ), которые действуют на почки, кишечник и кости. Циркулирующие концентрации кальция выше у детей, чем у взрослых, и диагностика гиперкальциемии у более молодых пациентов требует использования нормальных диапазонов, соответствующих возрасту.Гиперкальциемия у детей встречается реже, чем у взрослых.

    Наличие симптомов у человека с гиперкальциемией зависит от степени гиперкальциемии, продолжительности гиперкальциемии и возраста ребенка.

    Некоторые из наиболее распространенных симптомов включают:

    • Боль в почках (из-за камней в почках)
    • Боль в костях
    • Боли и боли
    • Боль в животе
    • Тошнота и рвота
    • Плохой аппетит
    • Запор
    • Хроническая усталость/усталость
    • Чрезмерная сонливость
    • Частое мочеиспускание
    • Повышенная жажда
    • Путаница
    • Мышечная слабость

    Когда концентрация кальция в сыворотке повышена лишь незначительно, у младенцев и детей симптомы могут отсутствовать или могут быть неспецифические симптомы, такие как легкая усталость или запор.В более тяжелых случаях дети могут стать очень слабыми и раздражительными, у них может быть тошнота и потеря аппетита, а также плохой набор веса, но у каждого ребенка симптомы могут проявляться по-разному.

    Гиперкальциемия имеет множество различных причин, как приобретенных, так и генетических. Приобретенные причины гиперкальциемии могут быть связаны с чрезмерным потреблением витамина D и кальция, низким уровнем фосфора, некоторыми лекарствами, кетогенной диетой, некоторыми инфекциями и снижением активности (иммобилизация). Гиперкальциемия может возникнуть у очень маленьких детей из-за избыточного действия витамина D, возникающего в результате повреждения кожи или жировой ткани или в результате генетических заболеваний.Гиперкальциемия также может сопровождать другие заболевания, такие как рак. Генетические причины гиперкальциемии могут быть связаны с различными нарушениями метаболизма витамина D, уровнями ПТГ и тем, как организм воспринимает кальций.

    Диагноз гиперкальциемии требует простого анализа крови для измерения уровня кальция в сыворотке. Для определения причины гиперкальциемии ребенку потребуются дополнительные лабораторные исследования, в том числе определение уровня в сыворотке крови фосфора, паратгормона и метаболитов витамина D.Кроме того, проводится оценка мочи для измерения уровня кальция.

    Гиперкальциемия с повышенным уровнем ПТГ предполагает наличие паратиреоидной причины, такой как первичный гиперпаратиреоз. При подозрении на это может быть выполнена визуализация паращитовидных желез. Вашему ребенку также могут сделать рентгенографию скелета и денситометрию костей (DXA-сканирование) для выявления истончения костей и эрозий, которые иногда связаны с гиперпаратиреозом. УЗИ почек может выявить отложения кальция в почках. Генетическое тестирование также может быть выполнено в зависимости от причины гиперкальциемии.

    Немедленное лечение гиперкальциемии будет основываться на степени гиперкальциемии и наличии симптомов у ребенка. Легкие случаи гиперкальциемии могут не требовать лечения или могут потребовать большего потребления жидкости, ограничения потребления кальция или витамина D или замены лекарств.

    В более тяжелых случаях у пациентов с большей вероятностью будут симптомы, и может потребоваться госпитализация для введения дополнительных жидкостей через вену (внутривенно), а также для использования препаратов, контролирующих кальций, которые вводятся перорально, инъекционно или внутривенно.У вашего ребенка будут часто брать образцы крови для проверки уровня кальция. Если выявлен первичный гиперпаратиреоз, может быть рассмотрено хирургическое вмешательство по удалению одной или нескольких паращитовидных желез.

    Долгосрочное лечение гиперкальциемии основано на конкретной основной причине.

    Гиперпаратиреоз | Кедры-Синай

    Не то, что вы ищете?

    Что такое гиперпаратиреоз?

    Гиперпаратиреоз возникает, когда 1 или несколько ваших паращитовидных желез гиперактивны.У вас есть 4 из этих крошечных желез. Каждый один размером с горошину. Они находятся на шее, рядом с щитовидной железой. Они поддерживают количество кальция в крови в пределах нормы. Они также сохраняют уровень магния и фосфора в норме. Если эти железы гиперактивны, они слишком много паратиреоидного гормона (ПТГ). Это повышает уровень кальция в крови.

    ПТГ вызывает высвобождение кальция из твоих костей.Эта потеря кальция из костей может привести к слабым, ломким костям. (остеопения и остеопороз) и переломы костей. Когда кровь с этим высоким содержанием кальция проходит через почки, кальций может фильтроваться с мочой. Это может привести к камни в почках.

    Что вызывает гиперпаратиреоз?

    Гиперпаратиреоз чаще всего происходит, когда одна из ваших паращитовидных желез увеличивается или на ней появляется опухоль.То железа затем вырабатывает слишком много паратиреоидного гормона. Большинство людей с этой проблемой имеют 1 ненормальный железа. У некоторых людей могут быть 2 аномальные железы. Небольшое количество людей имеет 4 ненормальных железы. Наличие 4 аномальных желез встречается редко. Часто это генетическая проблема. В большинстве случаев, если опухоль вызывает гиперактивность железы, опухоль не является раком (доброкачественная). В в редких случаях опухоль может быть раком.

    Кто подвержен риску гиперпаратиреоза?

    Вероятность гиперпаратиреоза у вас выше, если:

    • Ты женщина, которая уже ушла через менопаузу
    • У вас есть семейная история родственных условия
    • Вы ​​прошли курс лучевой терапии Голова и шея
    • Вы ​​принимали такие лекарства, как литий, лекарство, используемое для лечения биполярного расстройства, или некоторые диуретики (вода таблетки)
    • У вас снижен уровень витамина D

    Каковы симптомы гиперпаратиреоза?

    Каждый человек может иметь симптомы в другой путь.Но это самые распространенные симптомы:

    • Боли в суставах

    • Мышечная слабость

    • Депрессия

    • Боль в животе

    • ГЭРБ (гастроэзофагеальная рефлюксная болезнь)

    • Язвенная болезнь

    • Панкреатит

    • Сильная усталость (усталость)

    • Нарушение памяти

    • Мочеиспускание чаще, чем обычно

    • Повышенная жажда

    • Потеря аппетита

    • Путаница

    • Остеопороз

    • Камни в почках

    Эти симптомы могут выглядеть как другие проблемы со здоровьем.Всегда обращайтесь к своему поставщику медицинских услуг для диагностики.

    Как диагностируется гиперпаратиреоз?

    Анализ крови часто может выявить гиперпаратиреоз. Он может замечать высоко уровня кальция и паратиреоидного гормона. Генетическое тестирование может быть предложено, если гиперпаратиреоз распространен в вашей семье. Вам также может понадобиться анализ мочи. Это может измеряйте кальций в моче в течение 24 часов.

    Как лечится гиперпаратиреоз?

    Лечение будет зависеть от ваших симптомов, возраста и общего состояния здоровья. Это также будет зависеть на насколько тяжелое состояние.

    Варианты лечения

    • Хирургия. Если ваш случай более серьезный, может потребоваться удаление паращитовидной железы.Перед операцией у вас может быть визуализирующее исследование, чтобы выяснить, какая железа повреждена. аномальный. Также можно сделать УЗИ шеи. Знать, какая железа аномальные сократят операцию. Это также позволит хирургу сделать меньший разрез (разрез) прямо над аномальной железой.
    • Мониторинг. Если вы условие мягкий, ваш лечащий врач может внимательно следить за вашим состоянием, чтобы сделать уверен, что хуже не будет.
    • Лекарства. Ваш лечащий врач может назначить такие лекарства, как цинакалцет.

    Жизнь с гиперпаратиреозом

    Скорее всего, вам понадобится время от времени проверяются уровни кальция и витамина D, а также плотность костей.Ваше здравоохранение Тогда поставщик сможет убедиться, что ваша проблема находится под контролем.

    Когда мне следует позвонить своему лечащему врачу?

    Сообщите своему лечащему врачу, если ваши симптомы ухудшатся или появятся новые симптомы.

    Основные положения о гиперпаратиреозе

    • Гиперпаратиреоз возникает при или несколько ваших паращитовидных желез гиперактивны.Железы делают слишком много паратгормон. Это повышает уровень кальция в крови. Затем он понижается кальций в ваших костях.
    • Чаще всего это происходит, когда паращитовидная железа увеличивается или на ней появляется опухоль.
    • Потеря кальция из костей может приводят к ослаблению, ломкости костей (остеопении и остеопорозу) и переломам костей.
    • Обычный анализ крови может определить высокий уровень кальция.
    • Наиболее распространенным методом лечения является хирургическое вмешательство. удалить аномальную железу.

    Следующие шаги

    Советы, которые помогут вам получить максимальную отдачу от посещения вашего поставщика медицинских услуг:

    • Знайте причину вашего визита и то, что вы хотите, чтобы произошло.
    • Перед визитом запишите вопросы, на которые вы хотите получить ответы.
    • Возьмите с собой кого-нибудь, кто поможет вам задавать вопросы и помнить, что говорит ваш врач ты.
    • При посещении запишите название нового диагноза и любые новые лекарства, методы лечения, или тесты. Также запишите все новые инструкции, которые дает вам ваш врач.
    • Знайте, почему прописывается новое лекарство или лечение и как оно вам поможет. Также знать, каковы побочные эффекты.
    • Спросите, можно ли вылечить ваше состояние другими способами.
    • Знайте, почему рекомендуется тест или процедура и что могут означать результаты.
    • Знайте, чего ожидать, если вы не примете лекарство или не пройдете тест или процедуру.
    • Если у вас запланирована повторная встреча, запишите дату, время и цель этой встречи. визит.
    • Знайте, как вы можете связаться со своим поставщиком медицинских услуг, если у вас есть вопросы.

    Медицинский обозреватель: Роберт Херд, доктор медицины

    Медицинский обозреватель: Рональд Карлин, доктор медицины

    Медицинский обозреватель: Марианн Фоули RN BSN

    © 2000-2021 Компания StayWell, ООО.Все права защищены. Эта информация не предназначена для замены профессиональной медицинской помощи. Всегда следуйте инструкциям своего лечащего врача.

    Не то, что вы ищете?

    Фактор риска почечной недостаточности: кальций в сыворотке

    Что такое

    кальций и сывороточный кальций ?

    Кальций — это минерал, который в основном хранится в ваших костях.Но он также встречается по всему телу, включая мышцы и кровь. Вы должны получать кальций из своего рациона, так как организм не может его вырабатывать.

    Сыворотка кальций — это кальций в крови.

    Вам нужен кальций для следующих важных работ:

    • Форма костей и зубов
    • Заставляют мышцы двигаться (сокращения мышц), включая сердечную мышцу
    • Свертывайте кровь, чтобы не было слишком сильного кровотечения при порезе
    • Помогите сердцу поддерживать ровный сердечный ритм
    • Помогите нервам хорошо работать

    Кальций выходит из костей и попадает в кровь, когда это необходимо для поддержания нормального уровня кальция в сыворотке крови.Если вы не едите достаточно кальция, то слишком много выходит из костей. Когда из костей выходит слишком много кальция, кости становятся слабыми.

    Если кальций в сыворотке становится слишком низким, то достаточное количество кальция не может попасть в нервы, мышцы и раны. Это может вызвать серьезные проблемы с сердцем и другими мышцами, а также со свертываемостью крови.

    Почему у людей с заболеванием почек может снижаться уровень кальция в сыворотке крови?

    Наш организм не может вырабатывать витамин D.Мы можем получить витамин D только из пищи и подвергая кожу воздействию солнечных лучей. Здоровые почки могут принимать этот витамин D, который мы поглощаем, и превращать его в активную форму. Затем этот активный витамин D помогает нам усваивать кальций.

    Но при хронической болезни почек (ХБП) почки менее способны вырабатывать активный витамин D. Без достаточного количества активного витамина D вы усваиваете меньше кальция из пищи, которую едите, поэтому в крови его становится мало. Кроме того, дополнительный фосфор в крови людей с ХБП может связываться с кальцием в крови.Это может затем снизить уровень кальция в сыворотке.

    Нормальный уровень кальция в сыворотке крови составляет 8,5–10,2 мг/дл. Слишком низкий или слишком высокий уровень кальция в сыворотке может быть опасным, и оба состояния требуют лечения. Но было обнаружено, что у пациентов с низким уровнем кальция в сыворотке, даже на нижнем пределе нормы, почечная недостаточность развивается быстрее, чем у людей с более высоким уровнем кальция в сыворотке.

    Почему низкий уровень кальция в сыворотке крови является фактором риска развития почечной недостаточности?

    Исследования тысяч пациентов с ХБП показывают связь между низким содержанием кальция в сыворотке и более быстрым временем достижения почечной недостаточности, чем у пациентов с нормальным уровнем кальция.Низкий уровень кальция в сыворотке также связан с низким уровнем витамина D, вызванным ХБП. Таким образом, низкий уровень кальция в сыворотке может быть признаком того, что уровень витамина D слишком низкий, поскольку функция почек ухудшается и приближается к почечной недостаточности.

    Что я могу сделать, чтобы поддерживать нормальный уровень кальция в сыворотке крови?

    Соблюдайте сбалансированную диету. Другие питательные вещества, такие как магний и витамин D, необходимы для усвоения кальция. Диетолог, работающий с пациентами с заболеваниями почек, может помочь вам спланировать диету, соответствующую вашим индивидуальным потребностям.Молочные продукты богаты кальцием, но также могут содержать много фосфора 90 180 , содержание которого при ХБП обычно ограничено. Ваш диетолог может помочь вам найти здоровые альтернативы многим продуктам с высоким содержанием фосфора.

    Вам может понадобиться добавка витамина D, но ваша медицинская бригада должна будет заказать подходящую для вас добавку. Не принимайте добавки с витамином D или добавки с кальцием, если только ваша медицинская бригада не заказала их для вас. Если вам нужно лекарство под названием фосфатсвязывающее средство для снижения уровня фосфора, ваша медицинская бригада может порекомендовать лекарство, содержащее кальций.

    Для получения дополнительной информации:
    • Поговорите с лечащим врачом
    • Посетите Национальный почечный фонд на сайте www.kidney.org
    .

Leave a Comment

Ваш адрес email не будет опубликован. Обязательные поля помечены *