Описторхоз последствия для организма: 11.08.2017 Чем опасен описторхоз?

Содержание

11.08.2017 Чем опасен описторхоз?

Описторхоз – одно из самых распространенных паразитарных заболеваний человека. Это гельминтное заболевание, вызываемое плоскими паразитическими червями класса сосальщиков или, как их ещё называют, двуустками. У человека поражаются печень и желчевыводящие пути. Дело может дойти до инфекционных заболеваний, например, до гепатита. Или даже до онкологии. Заразиться можно, съев сырую, термически плохо обработанную речную рыбу, икру.

 За семь месяцев текущего года в нашей поликлинике выявлено три больных описторхозом. Заразившиеся были выявлены в ходе проведения профилактического осмотра – по результатам анализа кала.

Как пояснила врач-инфекционист поликлиники Елена Шестакова, для нашей области описторхоз — актуальное заболевание. Заразиться можно и привозной рыбой семейства карповых, и выловленной в местных водоемах. Для нашей местности характерно употребление в пищу такой рыбы, как карп, карась, красноперка, щука, язь и других. Вся эта рыба может представлять опасность. Поэтому крайне важно знать об особенностях заболевания, его признаках, а самое главное – о мерах профилактики. Обо всем этом и рассказала Елена Евгеньевна.

Как же паразиты попадают к человеку?

Ленточные черви с длиной тела от 8 до 18 мм и шириной от 1 до 2 мм сначала находятся в моллюсках и речной рыбе, а затем переходят к постоянным носителям — человеку или домашним животным. Источником размножения паразитов в реке являются улитки. А затем двуустка заселяется в рыбу. Человек съедает зараженную рыбу, и паразиты попадают в желчный пузырь, а потом в печень. Приблизительно через две недели они становятся половозрелыми и приступают к откладыванию яиц.

Как болезнь протекает

Это заболевание может протекать в средней, легкой и тяжелой форме. Легкая форма характеризуется плохим самочувствием, слабостью, обильной потливостью и незначительным повышением температуры. Средняя форма заболевания протекает с повышением температуры тела до 40 градусов и выше и с симптомами поражения верхних дыхательных путей. Признаки тяжелой формы заболевания проявляются резко: больной чувствует сильный озноб, общую слабость, может появиться сыпь, наблюдаются расстройства органов пищеварения, головная боль, ломота в мышцах и суставах, кашель, резкие боли в животе, температура тела повышается до 40 градусов. Спустя 2-4 недели состояние больного стабилизируется. Это связано с тем, что наступает хронический описторхоз. Это сопровождается серьезным поражением желчевыводящих путей, печени. Могут развиться панкреатит, холецистит и гастрит. Может произойти нарушение работы сердечно-сосудистой и нервной систем. Хронический описторхоз может сопровождаться и сильнейшей аллергией.

Надо помнить, что описторхоз – хроническое заболевание. Когда болезнь только начинается, то её очень сложно распознать, а переход из одной формы в другую происходит очень быстро.

Уберечься от последствий можно, если вовремя распознать проживание паразита в организме и немедленно приступить к квалифицированному лечению под строгим наблюдением врачей. Лечение описторхоза требует комплексного подхода. Наряду с приемом специфических противогельминтных средств врач предпринимает меры, направленные на восстановление нарушенной работы органов желудочно-кишечного тракта.

Как избежать заболевания

Но лечение этого заболевания – дело сложное и длительное. Поэтому важно предпринять все профилактические меры, чтобы избежать заражения. Для этого надо правильно рыбу приготовить.

Не менее важно, покупая рыбу, тщательно ее осмотреть и убедиться, что внутри нет паразитов, а запах и вид -нормальные.

Употреблять в пищу можно только хорошо прожаренную и проваренную, а также тщательно просоленную рыбу. Кроме того, следует обеззараживать продукт при помощи его глубокой заморозки.

Варить, жарить рыбу семейства карповых следует порционными кусками. Время ее приготовления должно быть не менее 20 минут с момента закипания бульона, начала жарки. И готовить рыбу в кастрюле или на сковороде лучше с закрытой крышкой. Рыбные пельмени необходимо варить дольше 5 минут. В процессе жарки котлет из карпа или его кусков необходимо следить за тем, чтобы каждая сторона продукта находилась в кипящем жиру не менее ¼ часа. Мелкую рыбу можно обрабатывать на плите в целом виде также не менее 15-25 минут. Рыбные пироги желательно выпекать около часа.

Для соления на 1 килограмм рыбы нужно брать не менее 300 грамм соли. Тёплым раствором рыбу солят не менее двух недель. Вяленую рыбу нужно засолить, а после выдерживать не менее трёх недель

Ни в коем случае нельзя употреблять в пищу сырую рыбу или пробовать рыбный фарш. Недопустимым является и кормление домашних питомцев сырой рыбой.

Во время разделки рыбы надо пользоваться специально отведёнными для этих целей кухонными принадлежностями.

Категорически запрещается выбрасывать на мусорные свалки и в водоемы отходы переработки рыбы, а также скармливать их животным, в том числе домашним, без предварительного обеззараживания.

Сегодня в мире выявлено более 21 миллиона человек, болеющих описторхозом. В нашей стране насчитывается более двух миллионов людей, пораженных этим паразитозом. Без соответствующего лечения организм человека приобретает множество сопутствующих болезней, победить которые не так просто. Однако своевременное выявление паразитов и качественное лечение поможет полностью избавиться от этой болезни. Но лучше всего вовсе постараться избежать этого заболевания. Сделать это можно, соблюдая перечисленные нами санитарно-гигиенические требования и правила.

Описторхоз против нас. Болезнь может прятаться в организме 20-40 лет | Здравоохранение | ЗДОРОВЬЕ

Наш округ относится к так называемой эндемичной территории по описторхозу. О профилактике, диагностике и лечении этого заболевания мы беседуем с кандидатом медицинских наук, зав. окружным центром вирусных гепатитов Дмитрием Чухлебо.

Портить воду себе дороже

— Дмитрий Михайлович, говорят, что процентов 90 северян точно заражены описторхозом, это действительно такая серьёзная проблема?

— Проблемы, в принципе, нет: есть заболевание — есть лечение. Местные жители страдают хронической формой, приезжие, как правило, — острой. Болезнь с течением времени (если вовремя не начать лечение) приводит к тяжёлым поражениям организма, вплоть до рака. Но люди не хотят ни проверяться на описторхоз, ни лечиться, если диагноз подтверждён. Все знают, что здесь речная рыба семейства карповых практически вся заражена, все знают, что нужно хорошо термически рыбу обрабатывать, но продолжают её есть, не досаливая и не дожаривая. Это выбор каждого. 

 

 фото: globallookpress.com

 

— Как личинки описторха попадают в рыбу?

— От человека. Это могут быть свалки в поймах рек и на льду водоёмов, сбросы канализационных вод и нечистот с судов без предварительной очистки, хозяйственные стоки, содержащие жизнеспособные яйца описторха. Одним словом, заражённая рыба обитает в водоёмах, в которые сбрасываются человеческие фекалии. Если люди будут пользоваться биотуалетами и перестанут сбрасывать нечистоты в реку, через несколько лет проблема исчезнет. Если мы будем придерживаться культуры еды и приготовления местной пищи, проблемы также не будет.

— Насколько легко диагностировать заболевание?

— В течение недели нужно сдавать кал, плюс анализ крови из вены. Всё. Перед сдачей анализов лучше попить желчегонные препараты. Многие говорят, мол, у меня ничего не болит. Боль появляется, когда процесс уже вовсю идёт. Большинство заболевших не обращаются за медицинской помощью, потому что заболевание протекает у них без явных клинических проявлений, практически незаметно, до того, пока не сформируется в хроническую форму.  А зачем ждать, пока враг заляжет, окопается и нанесёт максимальный вред? Представьте себе желчную протоку, такую прямую трубочку, личинки заселяются в неё и формируют ниши, в которых можно укрыться. Так трубочка превращается в «гроздь винограда», и убрать из этих отростков-ниш вредителей крайне сложно. Так зачем доводить заболевание до такой стадии? Если говорить о симптомах — описторхоз может быть основной причиной поллинозов, бронхиальной астмы, различных поражений кожи – проблемной кожи, псориаза, экземы. Больные обычно жалуются на боли в правом подреберье, тошноту, головные боли, боли в суставах и в мышцах, постоянную утомляемость, усталость. Он может  поддерживать язвенную болезнь желудка и 12-перстной кишки, воспаления поджелудочной железы, дискинезии желчевыводящей системы, гипертонии, бесплодия, облысения, различных расстройств со стороны сердечно-сосудистой системы (аритмии, экстрасистолии и др.), нервной системы (неврозы, депрессии), эндокринной и иммунной систем.

 

 фото:globallookpress.com

Чабрец против гельминтоза?

— А как сегодня лечится описторхоз?

— Есть отечественный препарат, есть немецкий, абсолютно без побочных эффектов. Если раньше описторхисов просто убивали и выводили из организма, что влекло за собой многочисленные побочные эффекты, в том числе – сильную интоксикацию, то сейчас лекарство действует мягче, оно влияет на присоски паразитов, не позволяя им прикрепляться к стенкам протоки. Но опять же, если заболевание в хронической стадии, то, сами понимаете, трудно добраться до мест, где прячутся паразиты и сложно их достать и извлечь. Поэтому лечение должно проводиться комплексно и очень серьёзно. При появлении болезненных ощущений в печени, желудочно-кишечном тракте, аллергических проявлениях, повышении температуры, возникших после употребления речной рыбы, нужно срочно обращаться за медицинской помощью к участковому терапевту. Лечение проводится в условиях стационара. И – главное – не только вывести паразитов, но и потом снова их не занести. То есть, нужно менять образ жизни и привычки.

 фото:globallookpress.com

— Мужчина попал в больницу и заявляет врачу, мол, я лечусь только травками. Врач говорит: давайте я покажу вашего единомышленника, который тоже только травками лечился. И приводит мужчину в морг. А что это с ним? – изумленно спрашивает пациент. – Наверное, чабрец с перитонитом не справился, — отвечает врач. А ведь многие действительно думают, что всё можно вылечить «народными методами»…

— Если человек не хочет знать, что происходит у него в организме и думает, что вот он сейчас попьёт травок, и всё наладится, — это его абсолютное право. Кому вы доверяете, к тому вы и пойдёте. Если вы доверяете врачу, а он – вам, болезнь остаётся в одиночестве. Доверяете незнакомым людям и их опыту — пожалуйста, верьте им и лечитесь так же, как они, упускайте свое время. А можно не лечиться совсем. Это тоже – вопрос выбора. Наше с вами дело – информировать. А выбор всегда остается за конкретным человеком. Нет такой обязанности – спасти всех. Только тех, кто сам этого хочет.

— Куда бежать в первую очередь, чтобы начать обследование?

— К участковому терапевту. Он назначит необходимые анализы и расскажет о дальнейших действиях.

Смотрите также:

Медицинские новости — БУЗ РА «Центр по профилактике и борьбе со СПИД»

Понедельник,  1  Июль  2019

Многие жители Республики Алтай любят рыбалку, особенно летом, когда сама природа так и манит взять удочку. В тёплое время более активно идёт уличная торговля свежей рыбой – карпы, лещи, караси и пр. Рыба – это ценный и питательный продукт, однако, употребляя местную рыбку, мы не всегда задумываемся, что её употребление способно принести большие проблемы со здоровьем.

Речной «сюрприз»
2018 году в Республике Алтай было зарегистрировано 89 случаев заболевания описторхозом. Это одно из самых распространённых паразитарных заболеваний человека, вызываемое плоскими паразитическими червями. При описторхозе у человека в первую очередь поражаются печень и желчевыводящие пути, последствия для здоровья могут быть самыми неблагоприятными. «Подхватить» описторхоз можно съев сырую, термически плохо обработанную речную рыбу, икру.

Как показывают наблюдения специалистов, в нашем регионе далеко не все любители рыбы готовят и едят этот продукт правильно, отсюда и такое количество заболевших этим недугом. По данным Управления Роспотребнадзора по Республике Алтай за 5 лет заболеваемость описторхозом в регионе выросла в 2 раза!

История заражения проста — люди заражаются описторхозом через речную рыбу, выловленную как при частном улове, так и купленную. Нередко болеют семьями.

Лещ, карась, карп…
Доктор медицинских наук, главный специалист-эксперт Управления Роспотребнадзора по РА Лилия Щучинова рассказывает:
— Прилавки рынков и магазинов сейчас радуют глаз: морская и речная рыба разных пород представлена в изобилии. Рыбу даже можно купить прямо у рыбаков: если вы ехали по трассе Барнаул – Горно-Алтайск, наверное, видели огромных вяленых лещей, висящих на перекладинах. Однако мало кто знает, что в одной такой рыбине может находиться до 7000 личинок описторхов. Личинки эти в рыбе не заметны – они микроскопичны, но опасность от этого меньше не становится… Нам, жителям Западной Сибири, об описторхозе надо знать всё, ведь мы живем в самом напряженном очаге описторхоза на планете.

По словам врача, описторхоз широко распространён среди рыбы семейства карповых, которыми так богаты реки Сибири — лещ, карась, карп, сорожка, чебак (язь), линь, пескарь, гольян, жерех и т.д.

— Моя знакомая заразилась описторхозам в гостях – не смогла удержаться при виде аппетитного вяленого леща. На следующие сутки она почувствовала тошноту и дискомфорт в животе. В это же время поднялась температура. Через неделю, не почувствовав улучшения, пошла к врачу. В общем анализе крови у заболевшей женщины нашли повышенное содержание эозинофилов. Как часто делается в таких случаях, врач назначил лабораторные анализы на гельминтозы, в том числе методом ИФА (иммуноферментный анализ). В сыворотке крови обнаружился высокий титр антител к описторхам. После лечения билтрицидом все симптомы прошли, — рассказывает Лилия Щучинова. —     Об этом случае я рассказала однажды на лекции. Когда закончила, ко мне подошла одна из слушательниц. «Мой муж – рыбак. Мы всю зиму едим вяленую рыбу. Можно я принесу её на анализ?» — спросила она. На следующий день дама принесла в паразитологическую лабораторию совершенно сухую рыбёшку. Рыбку на 2 дня замочили, а потом, зажав отрезанный кусочек мышцы между двумя стеклами, просмотрели под микроскопом – и нашли живых личинок описторхов! Рыба была завялена осенью, а анализ проводился в январе. Позже, у всех членов этой семьи обнаружился описторхоз, который протекал почти бессимптомно.

Готовьте правильно!
Не лучше ли совсем отказаться от речной рыбы? Или всё же есть способы сделать её безопасной для употребления в пищу? Врач успокоил: способы обеззараживания рыбы существуют и они довольно просты – рыбу нужно хорошо проваривать и прожаривать. Рекомендуется покупать рыбу в специализированных магазинах. Безопасна та рыба, которая хранилась в глубокой заморозке. Морская рыба, которая реализуется в нашей республике, обычно продаётся в замороженном виде, поэтому вряд ли можно заразиться от неё описторхозом.

— Раньше считалось, что вымораживание в бытовом холодильнике может обезвредить личинок описторхов, но потом один из исследователей не обнаружил, что даже на 3 неделе заморозки личинки остаются живыми. Они погибают только при очень низких температурах! Именно поэтому в Санитарных правилах теперь прописаны такие режимы заморозки рыбы: 32 часа при -28 градусах, 14 часов при -35 градусах, 7 часов при -40 градусах. Низкотемпературные холодильники должны быть на всех рыбоперерабатывающих предприятиях, — продолжает специалист.

Описторхи живут долго
Описторхоз – опасное заболевание, ведь чаще всего поражается жизненно важный орган – печень (реже – поджелудочная железа). Именно туда проникают личинки описторхов, если вы съели заражённую рыбу.
— Личинки прикрепляются к стенкам желчных протоков печени — и через 3 месяца вырастают до 1 см. Так как человек может подзаражаться описторхозом многократно, число паразитов в его организме может достигать 40 000 экземпляров. Причём, описторхи – долгожители среди глистов. Если не лечиться, они живут 30 лет! При большом скоплении описторхов желчные ходы забиваются ими – и появляется желтуха. Такие случаи у нас встречаются. Кроме того, в течение всей своей долгой жизни паразиты выделяют токсины, которые могут вызвать рак или цирроз печени, — предостерегает врач.

Диагноз ставится при обнаружении яиц описторхов в фекалиях больного или при обнаружении антител к описторхам в сыворотке крови. Сейчас описторхоз лечиться легко (курс лечения билтрицидом рассчитан на 1 день), но лучше лечиться в больнице, так как одновременно с назначением препарата проводят процедуры, чтобы удалить погибших описторхов из печени.

Итак, нашу речную рыбу надо есть с осторожностью – варите уху или жарьте рыбку в течение 20 минут. Остальные способы приготовления (копчение, посол, просушка) не убивают возбудителей описторхов.

О других рыбных паразитах
Кроме личинок описторха в рыбе могут находиться и другие опасные паразиты.

— В речной рыбе нередко бывают личинки широкого лентеца, который вызывает дифиллоботриоз. Правда, в отличие от описторхов, эти личинки довольно крупные – выглядят они как белые червячки до 1 см длиной. Внимательный человек заметит – и есть столь непривлекательную рыбу не станет. Если заражение всё-таки произойдет, то у человека через 3 месяца в кишечнике вырастет огромный – до 10 метров — ленточный червь. Присутствие его заметно – у больного человека при дефекации будут выходить белые ленты (обрывки это паразита). Лечится это заболевание (дифиллоботриоз) также как описторхоз — билтрицидом. Только дозировка препарата другая и госпитализации больного не требуется: выпил дома препарат – и здоров. Опасны щуки, ерши, налимы, окуни, а также икра этих рыб, — продолжает Л.Д. Щучинова. — В Горном Алтае есть разновидность дифиллоботриоза (чаечный лентец), но заражаются люди им редко, так как личинки чаечного лентеца находятся не в мышцах рыбы, а в кишечнике, который при потрошении рыбы удаляется. За время моей практики я всего дважды встречалась с больными дифиллоботриозом – оба случая были вызваны чаечным лентецом.
Но не только в речной рыбе живут паразиты. Большой спектр паразитов бывает в морских рыбах.

— Чаще всего люди видят личинок селёдочного червя – когда в селедке или другой морской рыбе (даже красной) обнаруживают свернутых спиралькой небольших белых червячков. Это анизакиды. Погибшие личинки вреда здоровью человека не приносят, но аппетита не прибавляют. Не так ли? А вот свежевыловленная рыба опасна. На Дальнем Востоке деликатесом является сырой рыбный фарш, приготовленный из красной рыбы. Хозяйки после посолки фарша видят, как анизакиды, словно травка, поднимаются из рыбной массы – и снимают живых червей ножом. Но горе, если удалят не всех – когда анизакида с рыбой попадает в рот человека и проглатывается, она способна внедриться куда угодно – в стенку пищевода или желудка, в миндалину. Проникая довольно глубоко, она вызывает страшную боль. Как правило, больные в этом случае попадают к хирургу, который удаляет внедрившихся личинок. Из-за опасности анизакидоза при промышленной ловле рыбы весь улов промораживается в холодильнике в течение 5 суток, чтобы анизакиды погибли. Добавлю, что если рыба сильно заражена личинками анизакид, ее бракуют, — делится специалист. — Опасны ракообразные – раки, креветки, крабы, живущие в пресноводных водоёмах Дальнего Востока и стран Юго-Восточной Азии. Если съесть их без термической обработки, они вызывают парагонимоз, протекающий с поражение лёгких, головного мозга и других органов. От этого заболевания больные нередко погибают. Говорю об этом потому, что сейчас наши люди выезжают на отдых за рубеж, пробуя без всякого страха экзотические местные блюда. Вряд ли они отдают себе отчёт, что подобные кулинарные изыски могут иметь очень неприятные последствия для здоровья. Совет один – рыбу и рыбопродукты можно употреблять только после термической обработки! А суши и роллы (с сырой рыбой) – не наша еда…


Опасность в рыбе! — Медицинский центр Здравница

Описторхоз(Opisthorchisis) — заболевание поражающее печень и поджелудочную железу. Возбудители— паразитические плоские черви из рода Opisthorchis.

 

Источники заражения описторхозом

Основной источник инвазии — больной человек и животные, с калом которых яйца возбудителей описторхоза попадают в воду, где их заглатывают улитки, в которых происходит размножение личинок паразита, заканчивающееся выходом в воду личинок-церкариев.

 

Церкарии проникают в карповых рыб (карп, карась, жерех, язь, елец, плотва, лещь, линь, чебак).

 

Пути заражения описторхозом

Заражение окончательных хозяев (человека и млекопитающих) описторхозом происходит при употреблении в пищу сырой, малосоленой, вяленой или недостаточно термически обработанной рыбы, содержащей инвазионные личинки.

Заразиться описторхозом очень просто в эндемичном очаге. Так как личинки паразитов находятся непосредственно в мышцах речной рыбы, то при ее разделке (в случае использования ножа, тарелки, разделочной доски для других целей) происходит загрязнение разделочного инвентаря и обсеменение других продуктов.

 

Формы существования возбудителей описторхоза

Попадая в желудок, капсула с паразитом переваривается, а тонкая гиалиновая оболочка разрывается самой личинкой в двенадцатиперстной кишке, откуда личинки возбудителей описторхоза проникают в желчный пузырь, желчные протоки и протоки поджелудочной железы.

Описторхисы выявляются во внутрипеченочных, желчных ходах у 100% инвазированных людей, в желчном пузыре — у 60%, в поджелудочной железе — у 36%.

Проникшие описторхии через 3-4 недели достигают половой зрелости и начинают откладывать яйца.

 

Таким образом, полный цикл развития возбудителя описторхоза (от яйца до половозрелого паразита) длится 4-4,5 месяца, после чего начинается продукция яиц.

Продолжительность жизни описторхисов достигает 20-25 лет, иногда и больше.

 

Клинические формы описторхоза

 

Описторхоз проявляется в двух формах:

-острый описторхоз (от нескольких дней до 4-8 недель и более),

-хронический описторхоз (продолжается 15-25 лет и даже пожизненно).

 

Острый описторхоз характеризуется:

  • лихорадкой,
  • крапивницей,
  • ломотой в мышцах и суставах,
  • позднее появляются боли в правом подреберье, под ложечкой,
  • наблюдается увеличение печени и желчного пузыря,
  • появляются боли и ощущение тяжести в эпигастрии,
  • тошнота,
  • рвота,
  • изжога,
  • частый жидкий стул,
  • метеоризм,
  • снижается аппетит.
  • При обследовании обнаруживают:
  • эрозивный гастродуоденит,
  • язвы желудка,
  • язвы двенадцатиперстной кишки.

У некоторых больных вострой фазе описторхоза появляются симптомы поражения легких, которые носят аллергический характер и протекают по типу астмоидного бронхита.

 

Хронический описторхоз проявляется симптомами:

  • хронического холецистита,
  • гастродуоденита,
  • панкреатита,
  • гепатита.

Появляются постоянные приступообразные боли в правом подреберье, напоминающие желчную колику, переходящие в правую половину грудной клетки. Отмечается диспепсический синдром, болезненность при пальпации в точке желчного пузыря, дискинезия желчного пузыря.

 

Желудок и кишечник также вовлекаются в патологический процесс, что проявляется признаками гастродуоденита и кишечной дисфункциипанкреатита – обычные последствия описторхоза.

 

Описторхозная инвазия приводит к нарушению деятельности нервной системы, о чем свидетельствуют частые жалобы больных на:

  • повышенную утомляемость,
  • раздражительность,
  • бессонницу,
  • головную боль,
  • головокружение

Наблюдаются потливость, тремор век, языка, пальцев рук.

 

В ряде случаев неврологическая симптоматика при заболевании описторхозом выступает на первый план, и больным ставят диагноз нейроциркуляторной дистонии и вегетативного невроза. Астенический синдром проявляется в жалобах на быструю физическую и умственную утомляемость, общую слабость.

 

Аллергический синдром при хроническом описторхозе проявляется:

  • кожным зудом,
  • крапивницей,
  • отеком Квинке,
  • артралгией,
  • пищевой аллергией.

Особенность хронической формы описторхоза заключается в том, что после успешной дегельминтизации в организме могут оставаться необратимые изменения в виде хронического гепатита, холангита, холецистита, гастрита, дисбаланс в иммунной системе.

 

В этой связи важное значение имеет реабилитация после курса лечения описторхоза — прохождение оздоровительных курсов для желчного пузыря, печени, улучшения пищеварения.

 

Последствия описторхоза

Самое серьезное последствие описторхоза – это аллергические реакции, возникающие в результате отравления организма продуктами обмена веществ и распада описторхисов, а также собственных тканей (клетки эпителия желчных протоков, подвергающиеся некрозу при травматизации паразитами).

Молодые гельминты травмируют стенки желчных и панкреатических протоков своими шипиками. Зрелые особи в процессе миграции захватывают и отрывают клетки эпителия своими присосками, оставляя множество кровоточащих эрозий и стимулируя бурную регенераторно-гиперпластическую реакцию эпителия, что может привести к возникновению онкологических заболеваний.

 

Скопление возбудителей описторхоза, их яиц, слизи, спущенного эпителия в протоках гепатопанкреатической системы создает препятствие для оттока желчи и панкреатического секрета, вызывая их застой.

 

К тяжелым осложнениям описторхоза относятся:

  • желчный перитонит,
  • абсцессы печени,
  • цирроз печени,
  • первичный рак печени.

Возможны осложнения описторхоза и со стороны поджелудочной железы:

  • острый деструктивный панкреатит,
  • рак поджелудочной железы.

Диагностика описторхоза

 

Диагноз «описторхоз» ставят на основе клинических данных и результатов лабораторных исследований крови, мочи, данных УЗИ, а также обязательно учитывают эпидемиологический анамнез: проживание или пребывание когда-либо в эндемичном очаге, употребление в пищу плохо термически обработанной рыбы карповых пород.

 

Иммунная система при контакте с описторхиями начинает вырабатыват антитела к ним. Эти антитела и выявляет лабораторная диагностика.

 

Однако при длительных сроках заболевания описторхозом наблюдается значительное снижение уровня специфических антител (грубо говоря, организм привыкает к живущим в нем паразитам и перестает вырабатывать антитела к ним. В этом случае лабораторная диагностика (ИФА, иммуноферментный анализ крови на наличие антител и антигенов к различным видам паразитов) не обнаружит наличие инвазии (заражения). Низкие концентрации антител можно определить только современными методами. Вегетативно-резонансное тестирование в случае хронического описторхоза подходит как нельзя лучше. Вне зависимости от того вырабатывает организм антитела к описторхиям или нет ВРТ сможет их выявить. Это связано с тем, что аппаратура фиксирует возбудителей по их частотным колебаниям (каждый живой организм имеет свою частоту колебаний).

 

Лечение описторхоза методом БРТ и РЧТ

 

После обнаружения описторхоза по результатам ВРТ следует незамедлительно начать лечение.

Лечение методами БРТ и РЧТ позволяет обойтись без назначения антибиотиков и значительно сократить время лечения. Вторым неоспоримым преимуществом использования указанных методов является последующая помощь организму в восстановлении после заражения описторхозом.

Ученые: паразиты-лямблии «взламывают» наши клетки

Автор фото, Science Photo Library

Подпись к фото,

Лямблиями может быть заражена грязная вода или не прошедшая достаточной термической обработки еда

Ученые изучили механизм питания паразитов-гиардий, которые возбуждают одно из самых часто встречающихся в мире заболеваний желудка. Как оказалось, паразиты, живущие у человека в тонкой кишке, имитируют некоторые функции организма, чтобы получить доступ к питательным веществам внутри клеток тонкой кишки.

Гиардии, также известные как лямблии, паразитируют в тонкой кишке человека, других млекопитающих и птиц.

Впервые кишечная лямблия была описана чешским медиком-анатомом Лямблем в 1859 году как возбудитель лямблиоза.

В России этим заболеванием болеют главным образом дети, но лямблиоз — большая проблема в странах Азии и Африки и в регионах мира, где нет доступа к чистой воде или где едят не обработанную термически пищу.

Каждый год в мире диагностируется около полумиллиона случаев лямблиоза, но до сих пор ученым не было известно, каким образом лямблии извлекают из тканей человека питательные вещества.

Как выяснили ученые из Университета Восточной Англии, паразиты пользуются для этого механизмом, который напоминает некоторые функции человеческого организма. Статья об исследовании опубликована в журнале GigaScience.

«Готовые блюда»

Как выяснилось, лямблии, живущие в тонком кишечнике, выделяют специальные вещества, чтобы расщеплять клетки стенок тонкого кишечника, в котором они живут.

Лямблии выделяют два вида белков, которые помогают им растворить слизистую оборочку кишечника и разорвать связь между отдельными клетками, чтобы получить доступ к питательным веществам.

Один из этих белков имитирует белок тенасцин, который может либо усиливать связь между клетками, либо ослаблять ее в случаях когда это необходимо, например при заживании ран.

Но «тенасцин», который используют лямблии, предотвращает заживание связывающих клетки элементов.

«После того как гиардии ломают межклеточные барьеры, открывая доступ к питательным веществам, другие бактерии получают возможность воспользоваться этими «готовыми блюдами», что в некоторых случаях усугубляет симптомы лямблиоза».

Автор фото, Getty Images

Подпись к фото,

Лямблиоз может грозить туристам или отдыхающим, которые пьют неочищенную воду

«Плохие бактерии»

Лямблиоз как правило через некоторое время проходит, либо для его лечения используют антибиотики.

Однако примерно половина носителей лямблии не испытывают никаких симптомов заболевания.

Как говорит доктор Тайлер, это может зависеть от соотношения «хороших» и «плохих» бактерий у нас в кишечнике.

Те, кто испытывают тяжелые симптомы, по версии доктора, имеют в кишечнике больше «плохих» бактерий, которые поглощают питательные вещества, высвобождаемые лямблиями.

«У некоторых в кишечнике доминируют достаточно хорошие бактерии, которые не вызывают воспаления и болей, а могут даже от них защищать.

«Мы считаем, что у некоторых людей в кишечнике много плохих бактерий, употребляющих высвобожденные лямблиями питательные вещества и вызывающих воспаление,» — продолжает ученый.

«Лямблия наносит изначальный ущерб, высвобождая питательные вещества внутрь кишки, а потом, если у вас много плохих бактерий, начинается цикл воспаления», — говорит Тайлер.

Именно поэтому для профилактики лямблиоза полезны йогурты и другие напитки с «хорошими» бактериями, добавляет доктор.

Новосибирский Гастроцентр в Новосибирске — отзыв и оценка — Irina

Очень неприятно писать отрицательный отзыв о работе данной клиники и в самом начале обращения туда я и подумать не могла, что придется отметить именно минусы. Но, все же считаю нужным предупредить других пациентов. Осень и наступает пора обострений и всплеска лечений распространенного в Сибири описторхоза.

Обратились сюда изначально по факту необходимости лечения гастрита у мужа. Точнее, если уж совсем быть точной, после обращения в Задравицу в Гастроцентр пришли к доктору Колобердину. Гастрит вылечили. Точнее, пришли к очередной ремиссии. Причину ряда сопутствующих, но не слишком донимающих проблем, так и не выявили. Но, это все прелюдия. Вообще самое интересное началось именно когда я сама обратилась за помощью так, как по результатам зондирования выявили, что и я оказалась в той самой зараженной группе.

Дело было прошлой осенью. Процесс выявления шел на фоне очередных ухудшений здоровья. Период как раз, когда хроника обостряется. И вот прихожу я с наконец найденной фактически самостоятельно проблемой к доктору, которая лечила наши с мужем гастриты — Рымар Инне Игоревне. Инна Игоревна доктор очень позитивный, отзывчивый. Выслушает, посмотрит, подберет схему лечения препаратами подейственней и посовременней. В общем, впечатления были самые благоприятные.

Инна Игоревна меня очень обрадовала, что вот и у них в Гастроцентре открывается стационар, будут лечить тот самый описторхоз и мне дивно повезло — попадаю под открытие, так что все будет гораздо дешевле, чем в среднем по больницам. Как тут не порадоваться? Само собой, собираю все анализы, необходимые исследования. День пребывала в стационаре, где кушала бильтрицид. Стационар вполне сносный на день, даже кормят т.к. данный препарат на голодный желудок — ни-ни.

Что меня удивило в процессе приема — полное отсутствие побочных эффектов. Меня все время спрашивали не тошнит ли. Вроде как должно тошнить, но бывает, что и ничего. В итоге, меня к концу дня все же подташнивало, но как только доехала домой и отвлеклась — тут же отпустило. В итоге понятно, что организм чисто выдал необходимые ощущения так, как капалось на мозг. В реальности никакой тошноты не было. Это при том, что у меня организм очень чутко реагирует на токсины в принципе. Если никому ничего, но легкий повод есть — у меня непременно проявится. А тут прям такая отрава и пустота ощущений. Но, на тот момент не придала особого значения. Нет негатива — да и замечательно. На следующий день приехала на капельницу и все прошло нормально.

Дальше ходила на зондирования и не раз (промывалась), принимала все препараты и вообще четко следовала инструкциям. Про зондирования — это отдельный разговор. Дуоденальное зондирование там проводит Данильчева Татьяна Васильевна. Одна из опытнейших специалистов Новосибирска. Но, с учетом того, что работает она одновременно с кучей народу (минимум 6 человек), то просто не успевает все делать качественно и четко следовать протоколу. Например, перчатки менять. Между пациентами в одних и тех же. Временные промежутки между этапами тоже не соблюдаются. В итоге и без того малоприятная процедура превращается в длительный адский кошмар. Но, в среднем по городу цена доступная. Далеко не самая дешевая, но доступная. Хотя… Вот в клинике Медакадемии, где данный специалист, кстати, тоже трудится, на зондировании 4 человека, цена в разы дешевле, процесс быстрее и качественней. Это к слову. 4 человека не 6 и не 10. А если их и вовсе 3 или 2… Как в других частных клиниках.

Так вот, пройдя через курс лечения и еще не закончив его мне становится плохо. Обостряется гастрит, появляется слабость и вообще как-то прям нехорошо. И боли, которые достают жутко просто. Обращаюсь к Инне Игоревне. Мне прописывают курс лечения, который не помогает. Стало хуже. Обращаюсь опять. Отменяют желчегонные, которые нужно было пить, промывания-зондирования, увеличивают дозировку препаратов от гастрита и для поддержки поджелудочной. После данных назначений мне еще хуже. Сыпь пошла, которая еще и чесалась кошмарно. Предполагаю, что наверно паразитов не отравили и они проснулись. Инна Игоревна мое предположение отрицает, вроде как рано судить и вообще я же лечилась, поэтому какие паразиты. Меняет препараты, но высокая доза остается.

В общем, мне и дальше становилось хуже. Более того, я начала худеть и достаточно быстро. Скинув 6 кило за 12 дней, не имея возможности ни есть нормально, ни спать, я самовольно прекратила пить прописанные препараты и, презрев запрет, сделал дуоденальное зондирование. По результатам — описторхи там размножаются. Их не много, но факт есть факт. К ним еще и лямблии откуда -то добавились.

Спасибо Татьяне Васильевне, что видя мое состояние оперативно со мной разобралась, а также посоветовала срочно менять врача и даже сказала, к кому обратиться. И вот по факту прекращения приема кучи препаратов мне уже стало чуть лучше, по факту приема препаратов, которые хотя бы глушат активность паразитов — состояние стабилизировалось.

При обращении к другому врачу выяснилось, что предложенная схема лечения в моем случае — как мертвому припарка. И это еще если не вдаваться в подозрения о качестве бильтрицида. Как оказалось, с ним нынче вообще серьезные проблемы и идет очень много контрафактной продукции. С учетом того, что ни реакции, ни результата — скорей всего контрафакт я и пила. Хотя, тут без претензии. Вряд ли сам персонал клиники об этом знал, а на каждую партию с экспертизами не набегаешься. Но, даже если бы препарат был нормальный ( а может он и был нормальным, я всего-то предполагаю по реакции организма, а не по факту доказательных практик), в моем случае он бы с высокой вероятностью не возымел нужного действия. Причина — не наладили нормальный отток желчи. При перегибе желчного пузыря желчегонными можно хоть упиться и не получить результат. И я при приеме в подготовительный период отметила, что реакции на желчегонные, похоже нет. Дюбажи — организм не реагирует. На зондирования — почти каждый раз застой. Реакция лечащего врача? «Ну, что-то там отходит все равно». Что-то отходит. Как-то так вот. Носорог с ним, что протоки забиты песком и воспаление идет полным ходом.

И это я промолчу про то, что при лечении этих паразитов показаны такие процедуры, как физио, массаж живота, промывания с экорсолом и желчегонными и пр. Да что там, мне в другой клинике даже курс лечебной физкультуры рекомендовали, который показан при лечении данного заболевания! Ничего этого в Гастроцентре нет, поэтому ничего и не назначают. Если обратитесь, пропьете отраву, поставят капельницу, промоетесь и все.Дальше пойдете пить желчегонные и две недели экорсола/популина. Хорошо работает желчный — велика вероятность, что будет результат. Плохо работает, проблемы, перегибы и пр. — видимо, это проблемы пациента.

И, по сути, даже видя явные ухудшения Инной Игоревной почему-то не был поставлен вопрос проконсультироваться с коллегами. Понимаю, ситуация была не типичная, Инна Игоревна больше по другим проблемам но все же. Почему тогда таких пациентов, как я, сразу не направляют к более профильным специалистам? Или надо непременно до острого панкреатита дойти и загреметь в стационар? Или там до язвы. А тот факт, что были ухудшения и явные, кстати, местный эндоскопист на ФГДС подтвердил (Колобердин), на УЗИ и в анализах тоже было все отлично видно. Нет, зачем-то надо было ждать. Наверно того, что сама сбегу и отстану.

Ну, сбежала. Отстала. Ситуацию мне исправили и стабилизировали. Но вот впечатления от Гастроцентра остались негативные после такого поворота событий.

Не рекомендую лечить здесь описторхоз. Особенно при наличии сопутствующих проблем с желчевыводящими путями. Дуоденальное зондирование — тоже больше не сюда. Вот по гастриту — пожалуйста, вылечат в лучшем виде. По остальным проблемам не обращались, так что не в курсе как и что.

СКЭНАР-терапия

 

      СКЭНАР-терапия — новое перспективное направление в медицине, рассматривающее человека как единую биоэнергетическую систему, в настоящее время интенсивно развивается во всем мире и меняет стереотипы, сложившиеся в современной медицине.

      СКЭНАР – аббревиатура способа воздействия на организм человека и название прибора (самоконтролируемая энергонейроадаптивная регуляция, самоконтролирующий энергонейроадаптивный регулятор).

      Это метод электролечения, воздействие импульсными токами  на участки кожи. Прибор работает как универсальный регулятор функций организма, поэтому мы можем использовать его при различных заболеваниях.

      Во время СКЭНАР-терапии на кожу воздействуют особые электрические импульсы, они вызывают в организме реакции, направленные на восстановление утраченных функций: 

  • уменьшить или снять боль;
  • повысить сопротивляемость болезни;
  • снизить выраженность симптомов;
  • ускорить течение болезни;
  • компенсировать уже возникшие изменения.

       Регулируя разбалансированные системы организма, СКЭНАР приводит в норму все, что способно восстановиться.

ОТЗЫВЫ ПАЦИЕНТОВ   

      Что лечит СКЭНАР?

      Есть множество заболеваний, как детских, так и взрослых, при которых способна помочь СКЭНАР-терапия.

В педиатрии:

      задержка физического и психического развития, иммунодефициты, ЧБД (часто болеющие дети), дисбактериозы, очаговая алопеция, кривошея, диатезы.

Заболевания нервной системы:

      головные боли, остеохондроз, невриты, плекситы, нарушения мозгового кровообращения и их последствия, последствия черепно-мозговой травмы, детский церебральный паралич, воспаление седалищного и бедренного нервов, гипертензионный синдром, пояснично-крестцовые заболевания, шейные радикулитные расстройства.

Заболевания костно-мышечной системы:

      артрозы, артриты, миозиты, отеки, травмы костей и суставов.

Заболевания сердечно-сосудистой системы:

      стенокардия, гипертоническая болезнь, гипотония, вегето-сосудистая дистония, патология сосудов конечностей, лимфостаз, лимфаденит, атеросклероз.

Заболевания дыхательной системы:

      бронхиальная астма, бронхиты, пневмония, плевриты, ОРВИ, ОРЗ, трахеит.

Заболевания органов пищеварения:

      язвенная болезнь, гастрит, энтероколит, дискинезия желчевыводящих путей, дисбактериоз кишечника, геморрой, панкреатит, холецистит, энтериты.

Заболевания мочевыделительной системы:

      аденома предстательной железы, мочекаменная болезнь, цистит, энурез, простатит.

Заболевания гинекологические:

      аднексит, болезненные менструации, киста яичников, маститы, мастопатии, нарушение менструального цикла, разрешение лактостаза, фибромиомы матки.

Заболевания ЛОР-органов:

      ринит, ангина, ларингит, гайморит, синусит, тонзиллит, фарингит, фронтит, этмоидит,отит, евстахеит, нейросенсорная тугоухость.

Заболевания полости рта:

      зубная боль, пародонтоз, пародонтит, воспаление слюнных желез, гингивит, гласит (воспаление языка), глубокий кариес, флюс.

Заболевания органов зрения:

      зрительное утомление, заболевания век, конъюнктивы.

Кожные заболевания:

      панариции, поражения кожи различной этиологии, послеожоговые рубцы, постинъекционные абсцессы, фурункулы, химический.

Косметологические эффекты:

      омоложение кожи, подтяжка лица, разглаживание морщин, укрепление мускулатуры.

 

Гиперэозинофильный синдром, кардиомиопатии и внезапная сердечная смерть при суперинвазивном описторхозе

Сердечно-сосудистая патология у пациентов с суперинвазивным описторхозом характеризуется серьезными изменениями гемодинамики и метаболизма миокарда, нарушением автоматизма сердца, возбудимости и проводимости мышц. Проведен анализ 578 случаев (медицинские и амбулаторные карты, отчеты патологоанатомических и судебно-медицинских вскрытий), зарегистрированных в учреждениях здравоохранения, лечивших описторхоз с гиперэндемическим очагом.Мы идентифицировали набор сердечных изменений у пациентов с гиперэозинофильным синдромом, ассоциированным с суперинвазивной описторхозной инфекцией, классифицировали патологические процессы в соответствии с МКБ-10 и описали их патогенез.

1. Введение

Сердечно-сосудистая патология у больных суперинвазивным описторхозом (СО) характеризуется резкими изменениями гемодинамики и метаболизма миокарда, нарушением автоматизма, возбудимости и проводимости сердечной мышцы.Были обнаружены достоверные прямые корреляции между частотой болевого синдрома и продолжительностью инвазии, частотой повторных инфекций и колебаниями стресса хозяина [1–3].

Гиперэозинофилия — это патологическое состояние, возникающее в результате гиперэозинофильного синдрома (ГЭК), при котором количество эозинофильных лейкоцитов в периферической крови превышает 15% (1,5 × 10 9 / л) [3–5]. Гиперэозинофильный синдром (как эпизод) наблюдается у всех больных описторхозом с множественными реинфекциями и периодом инвазии> 15 лет [3].

Наиболее подробное описание состояния миокарда при различных типах ГЭК при СО было достигнуто врачами, которые выявили развитие тяжелых форм миокардита и описали случаи внезапной сердечной смерти (ВСС) у пациентов с СО-ассоциированным миокардитом [6 , 7]. При исследовании больных описторхозом с гиперэндемическим очагом (Ханты-Мансийский автономный округ) увеличилась распространенность ненасильственной внезапной смерти у людей с некоронарогенной болезнью сердца. Механизмы реконструкции сердца при СО изучены недостаточно [8]; Таким образом, понимание сердечно-сосудистой патологии при описторхозе по-прежнему актуально и требует дальнейшего изучения.

В настоящее время ГЭК как очаг описторхоза встречается реже; тем не менее, ГЭК как осложнение СО недостаточно широко освещено в литературе. Необходимо искать другие факторы риска ВСС и разрабатывать меры по первичной профилактике сердечной смерти у пациентов с тканевыми гельминтозами.

2. Материалы и методы

Проведен анализ 578 случаев (медицинские и амбулаторные карты, отчеты патологоанатомических и судебно-медицинских вскрытий), зарегистрированных в учреждениях здравоохранения, лечивших описторхоз с гиперэндемическим очагом.Средний возраст пациентов составил 49,7 ± 3,4 года, средний возраст умерших — 52,3 ± 2,9 года. Были включены мужчины и женщины с соотношением женщин и мужчин 1,6: 1. Морфологическому исследованию были подвергнуты 110 сердец, а также печень (рисунки 1 и 2) умерших пациентов, в том числе сердца пациентов с внезапной сердечной смертью. Препараты окрашивали гематоксилином и эозином и красили по Ван Гизону по методикам Селье и Слинченко. Степень клеточной инфильтрации и склеротических процессов регистрировали путем определения показателя площади, занимаемой клеточными элементами и фиброзными структурами (%), а также их доли в составе инфильтратов.Окрашенные препараты подвергались светооптическому анализу, а изображения гистологических препаратов, полученные с помощью микроскопа и цифровой камеры Canon EOS 5D, сохранялись на компьютере. С помощью программы UTHSCSA Image Tool for Windows 3.0 была определена область метаболического некроза миокарда. Математическая и статистическая обработка данных проводилась на персональном компьютере с использованием программы Statistica 6.1 (Statsoft®).



3. Результаты и обсуждение

Сердечная боль (52.42%), нарушение ритма (72,31%), сердцебиение (28,20%) и расширение границ сердца влево (44,29%) были наиболее частыми патологиями у пациентов с СО; Изменения ЭКГ выявлены у 26,47% пациентов, пролапс митрального клапана — у 1/3 обследованных. При микроскопическом исследовании умерших от случайных причин и осложнений, связанных с СО, выявлены следующие изменения оболочек сердца: фуксинофильная дистрофия кардиомиоцитов и их апоптоз без лейкоцитарной среды вокруг мертвых элементов и диффузный кардиосклероз.Эти изменения относят к группе поражений, связанных с гипоксией вследствие синдрома Боткина, то есть систематическим коротким спазмом сосудов сердца.

Наиболее выраженной патологией, наблюдаемой при эозинофильном миокардите, является рассеяние и контаминация кардиомиоцитов экзометаболитами описторхов. В дальнейшем агрессия эозинофильных лейкоцитов с последующей гибелью миокардиальных клеток приводила к формированию обширных очагов депаренхиматизации мышечной оболочки и периваскулярного, цистоидного и диффузного кардиосклероза.Направление волокон коллагена совпадало с распространением экзометаболита паразита (рис. 3–6). В некоторых областях миокарда наблюдались очаги гибели клеток, вызванные нарушением обмена веществ (метаболический некроз без признаков воспаления) (рис. 7). Клеточный состав инфильтратов миокарда при ГЭК и внезапной смерти, связанной с ГЭК, представлен в таблице 1.






0,50 ± 0,06 900

No. Компоненты инфильтрата Доля клеток в инфильтрате, M ± m (%)
HES SCD, связанный с HES

1 WBC 66,17 ± 5,14 88,73 ± 4,81
Эозинофильный 76,31 ± 3,86 77,28 ± 2,84
Лимфоциты 8,34 ± 3,44 7.10 ± 2,08
Нейтрофильные 10,63 ± 2,68 12,12 ± 3,16
Моноциты 3,24 ± 0,83 3,00 ± 0,72
Базофильные 1,48 ± 0,01
2 Эндотелиоциты 8,66 ± 2,68 3,14 ± 1,22
3 Фибробласты 7,47 ± 3,01 3,05 ± 2,82
4 Фиброциты 10.14 ± 1,94 0,84 ± 0,08
5 Макрофаги 5,19 ± 2,63 4,08 ± 1,83
6 Плазмоциты 2,37 ± 0,94 0,16 ± 0,04

На окончательной стадии эозинофильной лейкоцитарной агрессии наблюдались фрагменты ядер, цитоплазмы и цитолеммы, что свидетельствует о «самоубийстве» эозинофилов во время контакта с антигенами ( O.felineus и загрязненные кардиомиоциты), который обозначается как EET (внеклеточные ловушки эозинофилов). Механизм аналогичен NETs (внеклеточные ловушки нейтрофилов), в которых лейкоциты (нейтрофильные и / или эозинофильные) высвобождают сеть из волокон ДНК и белков гранул.

Статистическая обработка данных по клеточному составу инфильтрата показала значительное увеличение лейкоцитов и уменьшение эндотелиоцитов (угнетение ангиогенеза), фибробластов и фиброцитов (отсутствие мотивации к замещению поврежденных участков миокарда) у пациентов с ВСС, ассоциированных с ГЭК, по сравнению с таковыми. у тех, кто умер от насилия в сочетании с ГЭК.Более того, при ГЭК при развитии внезапной сердечной смерти наблюдалось значительное увеличение площади метаболического некроза миокарда.

Внезапная сердечная смерть (ВСС) — актуальная проблема здравоохранения в России и за рубежом. Наиболее частой (более 80%) причиной внезапной сердечной смерти является ишемическая болезнь сердца, а фибрилляция желудочков (включая реперфузию) [9] играет ключевую роль в механизме танатогенеза [5, 10]. Кардиомиопатии вызывают внезапную сердечную смерть в 8,5% случаев и 71.4% этих случаев связаны с алкогольными кардиомиопатиями [10]. В популяции больных описторхозом с гиперэндемическими очагами внезапная коронарогенная сердечная смерть встречается реже; однако кардиомиопатии (воспалительные и невоспалительные), вызванные ГЭК, осложненные эозинофильным миокардитом, по нашим данным составляют 19%, а по другим авторам — более 17% [11].

Таким образом, патологические изменения сердца при СО объясняются нарушениями коронарного кровоснабжения по рефлекторному типу, аналогичному синдрому Боткина.Эти изменения сопровождались пароксизмальной кардиалгией, в результате которой развился диффузный кардиосклероз. Холецистокоронарный синдром наиболее выражен у пациентов с различными формами холецистита (хроническое осложнение СО).

Эозинофильные инфильтраты ГЭК постоянно обнаруживаются в почках (рис. 8), деснах (рис. 9) и слизистых оболочках тонкого и толстого кишечника. Кроме того, по всей длине энтодермального канала наблюдается выраженная гиперплазия лимфоидных клеток с расширением реактивных очагов лимфоидных фолликулов (рис. 10).Отложения экзометаболитов O. felineus обнаружены во всех органах, включая кишечник, легкие, кожу и десны. Клинические признаки ГЭК зависят от локализации (органы-мишени) эозинофильных лейкоцитов и метаболитов O. felineus ; таким образом, они могут проявляться либо как общие, неспецифические реакции, либо, например, при поражении аппендикса симптомы острого аппендицита очевидны, а инфильтрация в почках сопровождается только болью и не приводит к органной недостаточности.Танатогенетические механизмы внезапной сердечной смерти при ГЭК включают развитие фибрилляции желудочков. Другой механизм ВСС, тромбоэмболический синдром из-за париетального тромба на фоне эозинофильного панкардита, наблюдался в одном случае.




Гиперэозинофильный синдром при СО вызывается экзометаболитами описторхиса, которые загрязняют кардиомиоциты; последние впоследствии становятся аутоантигенами и мишенями для эозинофильных лейкоцитов.Помимо упомянутого выше клеточного иммунного ответа, существует гуморальный компонент (антитела к миокарду α -миозин) [12].

Гиперэозинофилия крови при описторхозе коррелирует с гиперэозинофилией тканей. Высокий уровень IL-5 и гиперпродукция IgE и IgG вовлечены в механизмы гиперэозинофилии [12].

Профилактика осложнений СО включает исключение первичных и рецидивирующих инфекций, устранение хронического воспаления и / или хирургических вмешательств при воспалении желчного пузыря.Эти меры, наряду с холецистэктомией, также предотвращают холеперитонит. Ключевую роль в профилактике сердечных патологий и внезапной сердечной смерти играет противопаразитарная терапия. Дегельминтизацию следует проводить в период хронической фазы болезни. Противопаразитарные препараты, применяемые в острой фазе и на пике ГЭК, осложняются повышенной эозинофилией, включая тканевую инфильтрацию, обострение эозинофильного миокардита и васкулит, что усугубляет ВСС. Анализы крови и материалы вскрытия показали, что даже при эозинофилии в более чем 10% всех белых кровяных телец дегельминтизация вызвала увеличение эозинофилов на 123–185% с развитием тканевой эозинофилии и эозинофильного миокардита.Лечение пациентов с ГЭК (синдромом Лоффлера), который постоянно встречается при СО, является довольно сложным и требует индивидуального подхода.

4. Заключение

При суперинвазивном описторхозе гиперэозинофильный синдром следует рассматривать как симптоматический ГЭК, при котором эозинофилия означает реактивное, неклональное, неограниченное поражение органов-мишеней инфекционным паразитарным агентом. Заболевания сердца при суперинвазивном описторхозе следует отнести к вторичным кардиомиопатиям, которые характеризуются как дилатационные, невоспалительные (дегенерация кардиомиоцитов, кардиосклероз) и метаболические (метаболический некроз).Воспалительные кардиомиопатии развиваются при ГЭК и эозинофильном миокардите, которые, в свою очередь, вызываются загрязнением кардиомиоцитов метаболитами описторхиса, превращая их в клетки-мишени для антигенов. Сходные механизмы альтерационных, экссудативных и пролиферативных процессов в сердце наблюдаются и при других глистных инфекциях [12–14].

Доступность данных

Все данные, лежащие в основе выводов, описанных в рукописи, полностью доступны без ограничений.Все соответствующие данные находятся в рукописи.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Fasciola Hepatica. Симптомы и лечение фасциолы гепатика

Синонимы: печеночная двуустка, печеночная гниль

Описание

Фасциолез вызывается двумя видами паразитических плоских червей или трематод, которые в основном поражают печень. Два вида трематод, вызывающих фасциолез ( Fasciola hepatica и Fasciola gigantica ), представляют собой листообразные черви, достаточно крупные, чтобы их можно было увидеть невооруженным глазом (взрослые F.hepatica размером 20-30 мм х 13 мм; взрослый F. gigantica размером 25-75 мм x 12 мм). Они вызывают аналогичные заболевания у людей. [1]

F. hepatica — паразит трематод (двуустка), поражающий людей и многие виды животных. F. hepatica — обычная причина фасциолеза. Это одна из самых крупных двуусток размером до 3,5 на 1,5 см. Паразит обитает в печени и желчных протоках. Его хозяевами являются травоядные млекопитающие, он встречается у 46 видов домашних и диких животных, а также у человека.Промежуточным хозяином является улитка из рода Lymnaea , которая обитает в болотистых местах и ​​в стоячей воде. F. gigantica может также вызывать подобное заболевание человека, а некоторые другие виды вызывают заболевание животных. Fasciola halli и Fasciola californica заражает овец и крупный рогатый скот в США и может быть синонимом Fasciola jacksoni , который заражает слонов в Африке и Индии, Fasciola nyanzae , хозяином которого является бегемот, и заражает магнезию. в основном олени, но также крупный рогатый скот и овцы.

Эпидемиология

  • F. hepatica встречается на всех континентах, кроме Антарктиды. F. hepatica инфицирует различные виды животных, но в основном травоядных. [2] Поражает жвачных животных гораздо больше, чем человека.
  • Фасциолез — одно из наиболее экономически важных паразитарных заболеваний домашнего скота, вызывающее болезни у овец и других домашних животных в Латинской Америке, Африке, Европе и Китае.
  • Считается, что из 750 миллионов человек, живущих в эндемичных районах, более 40 миллионов в общей сложности инфицированы трематодами пищевого происхождения. [3]
  • Конкретные цифры по F. hepatica оцениваются в 2,4 миллиона в 61 стране, а число подверженных риску составляет более 180 миллионов во всем мире. [4] Это наиболее распространено в Боливии, Эквадоре, Египте и Перу, но также встречается в европейских странах, включая Францию, Великобританию, Испанию и Португалию. Заболеваемость, по-видимому, увеличилась за 20 лет.

Жизненный цикл

[2]
  • Незрелые яйца выводятся в желчные протоки и с калом.Яйца выпускают мирацидии, которые вторгаются в подходящего промежуточного хозяина улитки.
  • В улитке паразиты развиваются в церкарии, которые высвобождаются из улитки и инцистируют в виде метацеркарий на водной растительности или других поверхностях.
  • Млекопитающие заражаются, поедая зараженную растительность. Люди заражаются при употреблении в пищу зараженных пресноводных растений, особенно кресс-салата.
  • После проглатывания метацеркарии проникают в двенадцатиперстную кишку и мигрируют через стенку кишечника, брюшную полость и паренхиму печени в желчные протоки, где развиваются во взрослых особей.Взрослые двуустки живут в крупных желчных протоках млекопитающего-хозяина.
  • Сообщалось также о заражении человека при употреблении в пищу сырой печени инфицированных овец, коз и коров.

Презентация

[2]

Хотя болезнь обычно рассматривается как болезнь развивающихся стран, она присутствует в Европе и развитых странах.

Острый фасциолез

  • В тяжелой форме он встречается у овец, но редко у человека и требует попадания в организм большого количества паразитов, обычно более 10 000 человек.Большое количество мигрирующих личинок проникает в печень и вызывает травматический гепатит, который часто заканчивается смертельным исходом. Иногда капсула печени может разорваться в брюшную полость, что приведет к смерти от перитонита.
  • Чаще всего инвазивная фаза длится несколько недель, при этом наиболее частыми симптомами являются перемежающаяся лихорадка, гепатомегалия и боль в животе, хотя до 50% инфекций могут быть субклиническими. [6]
  • Боль в животе обычно возникает в эпигастрии или правом подреберье.
  • Другие симптомы включают недомогание и истощение. Обычны крапивница и эозинофилия.

Хронический фасциолез

  • Достигнув печени, наступает латентная фаза, длящаяся месяцы или даже годы, когда инфекция протекает бессимптомно.
  • Однако по мере созревания может наступить обструктивная фаза, вызывающая гепатит, холангит или панкреатит. Fasciola spp. не приспособлены к использованию человека в качестве окончательного хозяина, поэтому сосальщики могут вызывать эктопические инфекции, особенно в легких и подкожных тканях, где они могут образовывать кисты.
  • Халзун — один из таких типов инфекции, вызванной употреблением сырой печени. Наблюдается тяжелый фарингит, дисфагия, ощущение инородного тела в горле и, возможно, обструкция дыхательных путей.

Дифференциальный диагноз

Потенциальный список обширен, но среди них:

Исследования

  • FBC обычно выявляет эозинофилию и, возможно, анемию. СОЭ может быть повышена.
  • LFT могут демонстрировать признаки гепатоцеллюлярного повреждения или свидетельства обструкции.
  • Микроскопия кала может показать патоген или яйца. [2]
  • Доступны различные иммуноанализы, а тесты иммуноферментного анализа (ELISA) чувствительны и специфичны. [2]
  • На рентгеновском снимке печени могут быть обнаружены небольшие абсцессы, похожие на тракт, и субкапсулярные поражения.
  • Даже при легочных симптомах рентгенография редко приносит пользу.
  • УЗИ желчного пузыря и желчевыводящих путей может выявить взрослых червей как очаги повышенной эхогенности. [7]
  • Холангиография может выявить множественные кистозные расширения протоков. Большое кистозное расширение, малая кистозная эктазия и расширение, напоминающее шелковицу, считаются диагностическими признаками фасциолеза.

Ведение

Немедикаментозное лечение

Рекомендуется постельный режим и диета, богатая белками. Может потребоваться железо и витамины.

Наркотики

[2]

В таком случае обратитесь за советом к специалисту. Триклабендазол — препарат выбора.Празиквантел неэффективен и поэтому не рекомендуется.

Хирургический

  • Удаление паразитов при эндоскопической ретроградной холангиопанкреатографии эффективно на стадии желчевыводящих путей.
  • Восходящий холангит может потребовать хирургического вмешательства.

Осложнения

Прогноз

Болезнь редко убивает людей. При адекватном лечении прогноз отличный.

Профилактика

  • Водные овощи следует мыть 6% -ным уксусом или перманганатом калия в течение 5-10 минут, что убивает инцистированные метацеркарии.Такой подход более успешен, чем попытки отказаться от употребления сырых овощей.
  • Тщательно готовьте водные овощи перед едой.
  • Избегайте загрязнения сточными водами зон выращивания.
  • Использование моллюскицидов — наиболее частое вмешательство общественного здравоохранения, поскольку оно предотвращает передачу многих других трематод, включая Schistosoma spp.
  • Применена обработка животных для уменьшения водоема и снижения потерь поголовья. До введения однократной дозы триклабендазола битионол был единственным доступным лечением, сильно ограниченным по стоимости и продолжительности лечения.
  • В будущем вакцинация представляется возможным вариантом. [9]

Патогены | Бесплатный полнотекстовый | Миграция, колонизация и патогенез O. viverrini, коинфекция CagA + Helicobacter pylori

1. Введение

Хроническая инфекция людей канцерогенным печеночным двуустником Opisthorchis viverrini является серьезной проблемой общественного здравоохранения в регионе Нижнего Меконга, в том числе Таиланд, Лаосская Народно-Демократическая Республика, Камбоджа и Южный Вьетнам.Примерно десять миллионов человек в этих регионах инфицированы именно этой печеночной двуусткой [1]. В Таиланде самая высокая распространенность отмечается в северо-восточной части, где инфицировано около шести миллионов человек [2,3]. Заражение происходит при употреблении в пищу сырой или недоваренной пресноводной рыбы, содержащей инфекционную стадию (метацеркарию) паразита. После проглатывания хозяином метацеркария выходит из двенадцатиперстной кишки. Затем червь попадает в желчный проток через ампулу Фатера, прежде чем мигрировать во внутрипеченочные желчные протоки, где он превращается во взрослого червя.Хроническая инфекция желчных протоков вызывает несколько гепатобилиарных аномалий, включая перидуктальный фиброз желчных протоков и холангиокарциному (ХА), вызывающую смертельный рак желчных протоков. Так, O. viverrini был классифицирован Международным агентством по изучению рака (IARC) как биологический канцероген группы 1 для человека [4]. Интересно, что недавние исследования показали, что O. viverrini, коинфицированная Helicobacter pylori, может обострять гепатобилиарные заболевания и управлять описторхозом, опосредованным CCA [5] .H. pylori, палочковидная бактерия из рода Proteobacteria, классифицируется как канцероген группы 1, который, как известно, вызывает рак желудка [4].H. pylori можно разделить на две основные субпопуляции в зависимости от наличия или отсутствия гена cagA, ключевых факторов вирулентности, участвующих в патогенезе заболевания, кодирующего белок CagA: cagA-положительные и cagA-отрицательные штаммы [4]. Протеобактерии — ключевая популяция микробиот, обнаруживаемая в червях, образцах желчи и фекалиях хомяков, инфицированных O. viverrini [6]. Последующее исследование показало, что печеночная двуустка является резервуарным хозяином H. pylori [7]. Кроме того, коинфекция O.viverrini с H. pylori усиливали гепатобилиарное воспаление и перидуктальный фиброз на модели хомяка [8]. У людей из районов, эндемичных по O. viverrini, частота инфицирования H. pylori выше у инфицированных O. viverrini, чем у неинфицированных жителей [9]. Следует отметить, что бактериальная нагрузка H. pylori положительно коррелирует с интенсивностью инфекции O. viverrini. Интересно, что перидуктальный билиарный фиброз, основная патологическая характеристика хронического описторхоза, связан с cagA-положительным H. pylori [9].Boonyanugomol et al. [10] сообщили о значительно более высоком уровне выявления H. pylori в образцах желчи пациентов с ОСА (66,7%) по сравнению с контрольной группой без рака (25,0%). Более того, cagA-положительные H. pylori имели значительно более сильную связь с CCA, чем холелитиаз или контрольная группа, не являющаяся раком в исследовании. Эти данные позволяют предположить, что cagA-положительный H. pylori участвует в патогенезе гепатобилиарных аномалий и ОСА.

Однако, несмотря на тесную связь между двумя канцерогенными патогенами, упомянутыми выше, лежащие в основе механизмы остаются неуловимыми.Таким образом, это исследование на модели хомяка было направлено на изучение взаимосвязи между O. viverrini и H. pylori, с особым вниманием к тому, как H. pylori мигрирует, колонизирует и вызывает патологии желчных протоков при коинфекции O. viverrini.

2. Материалы и методы

2.1. Препарат метацеркарии
Метацеркарии на стадии инфицирования O. viverrini были получены от естественно инфицированных пресноводных карповых рыб в эндемичных районах Таиланда. Пять кг свежей рыбы измельчали ​​и переваривали в синтетическом желудочном соке, содержащем 0.15% соляной кислоты (HCl) и 0,25% пепсина и инкубируют на водяной бане при 37 ° C в течение 1 ч. После разложения суспензию фильтровали через серию медных сит с разным размером пор для удаления твердых частиц и осаждения в физиологическом растворе, как сообщалось ранее [11]. Метацеркарии O. viverrini были идентифицированы под препаровальным микроскопом, как описано ранее [12]. Пятьдесят метацеркарий скармливали хомякам посредством внутрижелудочной интубации.
2.2. Бактериальный препарат
Два бактериальных штамма, cagA-положительный и cagA-отрицательный H.pylori, меченный зеленым флуоресцентным белком, мутантным геном 2 (gfpmut2), был любезно предоставлен профессором Р. Хаасом, Институтом гигиены и медицинской микробиологии Макса фон Петтенкофера [13]. Оба штамма выращивали на чашках с селективным агаром GC с добавлением хлорамфеникола 6 мг / л (добавка хлорамфеникола, Oxoid Limited, Хэмпшир, Англия), 10 мл / л vitox (добавка Vitox, Oxoid Limited, Хэмпшир, Англия), Dent (H. pylori селективная добавка, Oxoid Limited, Хэмпшир, Англия) и лошадиная сыворотка (5%).Планшеты инкубировали в течение 4–5 дней при 37 ° C в 6–12% O 2 и 5–8% CO 2 в микроаэробной атмосфере, регулируемой 1 саше / сосуд 2,5 л газогенератора (AnaeroPack-MicroAero Gas Generator , Mitsubishi Gas Chemical Co. Ltd., Токио, Япония) [14]. После достаточного бактериального роста колонии H. pylori суспендировали в бульоне Brucella, перемешивали и несколько раз промывали, доводя до 1,7 × 10 8 колониеобразующих единиц (КОЕ) / мл [15]. Хомякам давали 1 мл бактериального раствора перорально через желудочный зонд через 24 ч после голодания.
2.3. План эксперимента
Шестинедельные самцы сирийских хомяков (n = 50) были разделены на 5 групп по 10 животных в каждой (рис. 1а). Группа I (OV): инфекция O. viverrini, группа II (OV / HP +): O. viverrini + cagA-положительная инфекция H. pylori, группа III (OV / HP-): O. viverrini + cagA-отрицательная инфекция H. pylori инфекция, группа IV (HP +): cagA-положительная инфекция H. pylori, группа V (HP-): cagA-отрицательная инфекция H. pylori. Всех животных содержали в условиях контролируемой температуры и дневного / ночного цикла, и им давали пищу и воду ad libitum.Это исследование на животных было одобрено Комитетом по этике животных Университета Хон Каен (AEKKU # 41/2561).

Пять хомяков на группу были умерщвлены путем ингаляции изофлурана через 1 и 3 месяца после заражения и были собраны печень, желудок, желчная жидкость, кровь и гельминты. Печень фиксировали в 10% нейтральном забуференном формалине и обрабатывали обычным парафиновым гистологическим методом. Затем парафиновые срезы использовали для иммунофлуоресцентных и иммуногистохимических исследований.

Дополнительные эксперименты для краткосрочного изучения были О.viverrini и cagA-положительная совместная миграция H. pylori, назначенная через 1 и 3 часа после заражения (рис. 1b). Пять хомяков за период времени были умерщвлены, и образцы были собраны, как описано выше.
2.4. Экстракция ДНК
Цельную кровь (250 мкл на животное) повторно лизировали в буфере для лизиса эритроцитов (0,32 М сахароза, 10 мМ Tris HCL, 5 мМ MgCl 2 , 0,75% Тритон-X-100) до получения белого осадка. [16]. Цельную желчную жидкость центрифугировали при 5000 × g в течение 5 мин при 4 ° C. Гранулы крови и желчи, 1 г ткани желудка и образцы цельного червя использовали для экстракции ДНК стандартным фенол-хлороформным методом [17].Вкратце, образцы инкубировали с буфером для экстракции ДНК, состоящим из 20 мМ Трис-HCl, 1 мМ EDTA, 10 мМ NaCl, 10% додецилсульфата натрия, доведенного до pH 8. Образцы желудка и червя гомогенизировали с помощью измельчителя тканей и расщепляется протеиназой K (10 мг / мл протеиназы K, 50 мМ Tris-HCl, pH 7,5) при 55 ° C в течение ночи. Затем ДНК отделяли от растворов образцов экстракцией фенолом и хлороформом и осаждали этанолом. Концентрацию ДНК измеряли с помощью спектрофотометра NanoDrop® ND-1000 UV-Vis (Thermo Fisher Scientific, Inc., Waltham, MA, USA) и доведена до 50 нг / мкл.
2,5. Полимеразная цепная реакция в реальном времени (qPCR) для обнаружения гена gfp
Рекомбинантная плазмида phel12, содержащая gfp, экстрагировалась с использованием набора для экстракции плазмид (GeneJET Plasmid Miniprep Kit, Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) и использовалась для получения стандартная кривая КПЦР. Число копий ДНК рассчитывали, как описано ранее [18], с размером phel12, содержащего gfp, равным 5116 п.н. Раствор плазмиды серийно разводили в 10 раз, в результате чего разведения составляли от 1 нг / мкл до 1 фг / мкл.Абсолютную количественную оценку выполняли путем создания стандартной кривой для каждого gfp и построения графика значений цикла количественной оценки (Cq) против log [количество] серии разбавлений с известными количествами gfp.

Реакционная смесь состояла из 10 мкл 1x Master Mix (FastStart Universal SYBR Green Master (Rox), Roche, Mannheim, Germany), содержащей ДНК-полимеразу FastStart Taq, реакционный буфер, нуклеотиды (dATP, dCTP, dGTP и dTTP), SYBR Зеленый I и эталонный краситель. Набор праймеров gfp, прямой TCCATGGCCAACACTTGTCA и обратный CATAACCTTCGGGCATGGCA в объеме 0.В реакционную пробирку добавляли 6 мкл 300 нМ с 6,8 мкл стерильной дистиллированной воды, смешанной с диэтилпирокарбонатом (DEPC). Образец ДНК использовали в количестве 2 мкл на реакционную пробирку, доведя конечный реакционный объем до 20 мкл. Условия ПЦР и кривой плавления были установлены как 94 ° C 30 с, 58 ° C 30 с, 72 ° C 45 с (50 циклов) и 95 ° C 30 с, 60 ° C 60 с, 95 ° C 15 с. Ожидаемый размер генного продукта составлял 112 п.н.

2.6. Иммунофлуоресценция для локализации H. pylori-GFP

Срезы ткани печени депарафинизировали и регидратировали перед извлечением антигена в микроволновой печи в 10 мМ лимонной кислоте, pH 6.0 при 100 Вт в течение 5 минут и 20 Вт в течение 15 минут. Срезы охлаждали в течение 30 минут, дважды промывали фосфатно-солевым буфером (PBS) и блокировали эндогенные пероксидазы 3% H 2 O 2 в метаноле. После блокирования неспецифического связывания белков с помощью 1% бычьего сывороточного альбумина в течение 1 ч срезы инкубировали с мышиным моноклональным антителом против GFP (клон: GFP-20; G6539, Sigma-Aldrich, Сент-Луис, Миссури, Миссури, США. ) при разведении 1: 1000 в трис-буферном солевом растворе (TBS) при 4 ° C в течение ночи.После промывки срезы инкубировали со вторичным антителом (разведение 1: 500), меченным Alexa488 козьим антимышиным иммуноглобулином (Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) в течение 30 мин. После окрашивания красителем Hoechst (разведение 1: 2000 в TBS) в течение 10 мин окрашенные срезы помещали в 10% глицерин и наблюдали под флуоресцентным микроскопом (Olympus BX51, Olympus Corporation, Синдзюку-ку, Токио, Япония). Экспрессию GFP подтверждали двойным иммунофлуоресцентным окрашиванием 1:50 в TBS кроличьем анти-H.pylori поликлональное первичное антитело (штамм H. pylori CH-20426; B0471, DakoCytomation, Glostrup, Дания). В качестве вторичных антител использовали козьи антитела против мыши Alexa488 (разведение 1: 500 в TBS) и ослиные антикроличьи антитела Alexa594 (разведение 1: 500 в TBS) (Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) в течение 1 часа.

2.7. Препарат O. viverrini Экскреторно-секреторные продукты
Экскреторно-секреторные продукты получали путем культивирования взрослых червей in vitro при 37 ° C в среде RPMI-1640, содержащей пенициллин (100 Ед / мл), стрептомицин (100 мкг / мл) и ингибиторы протеаз ( 0.1 мМ фенилметансульфонилфторид (ФМСФ), 1 мМ лейпептин и 0,1 мМ N- [N- (L-3-транс-карбоксиран-2-карбонил) -L-лейцин] -агматин, E-64). Экскреторно-секреторные продукты собирали из среды живых червей каждые 12 ч в течение 7 дней. Среду центрифугировали для удаления яиц (1000 × g, 10 мин при 4 ° C). Прозрачный супернатант концентрировали и липополисахарид (ЛПС) удаляли с помощью Triton-X114 (Sigma-Aldrich, Миссури, Миссури, США), как описано ранее [19]. После удаления остаточного тритона-X114 с помощью Bio-Beads SM2 (Bio-Rad, Калифорния, Калифорния, США) экскреторно-секреторные продукты фильтровали через фильтр 0.2-микрометрическая мембрана, белок измеряется, аликвотируется и хранится при -80 ° C для последующих анализов in vitro.
2,8. Анализ адгезии H. pylori

Линия нормальных эпителиальных клеток желчных путей H69 была засеяна (1 × 10 5 клеток / культура) на обработанные NaOH покровные стекла и культивирована в обогащенной среде, которая представляла собой смесь 45% модифицированной Дульбекко среды Игла. : Смесь питательных веществ F-12 (DMEM / F12, Gibco / Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США), 45% DMEM с высоким содержанием глюкозы (Gibco / Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) с добавлением 10% фетальной бычьей сыворотки, пенициллина (100 Ед / мл), стрептомицина (100 Ед / мл), аденина 25 мкг / мл, инсулина 5 мкг / мл, адреналина 1 мкг / мл, гидрокортизона 0,62 мкг / мл, T3 13,6 нг / мл, эпидермальный фактор роста 10 нг / мл и инкубировали при 37 ° C в увлажненной атмосфере с 5% CO 2 в течение трех дней. Клетки H69 обрабатывали либо H. pylori при 80% конфлюэнтности при множественности инфекции (MOI) 1: 1, либо подвергали воздействию MOI 1: 1 H. pylori в присутствии 20 мкл / мл экскреторно-секреторных продуктов в течение 24 часов. .После инкубации клетки промывали стерильным PBS и фиксировали смесью 1: 1 метанол: ацетон в течение 5 мин. После отмывки клетки инкубировали с раствором, блокирующим белок DAKO (Dako Protein Block Serum Free: X0909, DakoCytomation, Glostrup, Дания) в течение 20 минут при комнатной температуре и инкубировали с мышиным анти-H в разведении 1: 500. pylori (клон: BD1586; SC57780; Santacruz Biotechnology, Texas, Vt., США) и кроличьи поликлональные первичные поликлональные антитела против бета-актина (разведение 1: 250) (Ab8227; Abcam, Кембридж, Великобритания) в течение 1 часа.Затем клетки промывали и инкубировали с 1: 500 козьими антителами против IgG-Alexa488 мыши и 1: 500 ослиными анти-кроличьими IgG-Alexa594 (Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) в течение 1 часа. После тщательной промывки PBS клетки помещали в среду DAPI (реагент ProLong Gold antitifade, Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) для ядерной визуализации и просматривали под флуоресцентным микроскопом (Olympus BX51, Olympus Coperation, Shinjuku- ку, Токио, Япония). Количество прикрепившихся H. pylori оценивалось вручную при 40-кратном увеличении для 10 неперекрывающихся полей зрения.

2.9. Анализ эпителиальной трансмиграции

Эпителиальную трансмиграцию H. pylori изучали с использованием клеточной линии H69 с определением количества клеток и подготовкой слайдов, как описано для анализа адгезии H. pylori. Для плана эксперимента клеточные линии были разделены на две группы. В группе 1 cagA-положительные H. pylori добавляли к 80% конфлюэнтных культур клеток при MOI 1: 1. Для группы 2 80% конфлюэнтных культур подвергались воздействию 1: 1 MOI cagA-положительной H. pylori в присутствии 20 мкг / мл экскреторно-секреторных продуктов.Обе группы культивировали в течение 3, 6 и 24 часов. После инкубации клетки промывали стерильным PBS и фиксировали смесью 1: 1 метанол: ацетон в течение 5 мин. Затем клетки инкубировали с раствором, блокирующим белок DAKO (Dako Protein Block Serum Free: X0909, DakoCytomation, Glostrup, Дания) в течение 20 минут при комнатной температуре. Срезы клеточных культур инкубировали с первичными антителами в разведении 1: 500 мышиных анти-H. pylori моноклональное первичное антитело (клон: BD1586; SC57780; Santacruz Biotechnology, Texas, Vt., США) в TBS и кроличьем поликлональном первичном антителе против E-кадгерина (24E10) (разведение 1: 200 в TBS) (3195; Cell Signaling, Массачусетс, Массачусетс, США) в течение 1 ч, промывали и затем инкубировали со вторичным антитела 1: 500 козьих антимышиных Alexa488 и 1: 500 ослов против кроличьих Alexa594 (Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) в течение 1 часа. Клетки помещали в среду DAPI (антифадный реагент ProLong Gold, Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) и оценивали на наличие доказательств трансмиграции H. pylori через клеточную щель при увеличении 40–100 × под конфокальным микроскопом.Слои с множеством изображений были созданы на конфокальном микроскопе UltraVIEW VoX Spinning Disk от PerkinElmer с использованием программного обеспечения Volocity, в то время как трехмерные изображения конструкции были выполнены с помощью конфокального сканирующего микроскопа LSM800 от Carl Zeiss с использованием программного обеспечения Zen black.

2.10. Гистопатология и иммуногистохимия E-кадгерина

Срезы ткани печени депарафинизировали и регидратировали перед окрашиванием гематоксилином и эозином (H&E) (Sigma-Aldrich, Миссури, Миссури, США). Были исследованы гистопатологические исследования, такие как перидуктальное воспаление, метаплазия бокаловидных клеток, дисплазия желчных протоков и митотические показатели.Экспрессия

E-кадгерина была обнаружена иммуногистохимическим методом, аналогичным иммунофлуоресцентному окрашиванию, упомянутому выше. Вкратце, срезы печени инкубировали с моноклональным первичным антителом против E-кадгерина (клон: NCH-38; M3612; DakoCytomation, Glostrup, Дания) в разведении 1:50 в TBS при 4 ° C в течение ночи. Затем слайды инкубировали с биотинилированным козьим антителом мыши / кроличьим иммуноглобулином (K0675; DakoCytomation, Glostrup, Дания) в TBS при разведении 1: 100 в течение 1 часа. После трех тщательных промываний слайды инкубировали в растворе комплекса стрептавидин-биотин-пероксидаза хрена (HRP) (Enzyme Label) (K0355; DakoCytomation, Glostrup, Дания) в течение 1 часа.Несвязанный избыток стрептавидиновых комплексов удаляли путем тщательной промывки, затем слайды проявляли в растворе тетрагидрохлорида диаминобензидина в течение 5 минут и промывали водопроводной водой. Срезы печени контрастировали гематоксилином Майера, обезвоживали, очищали, монтировали и наблюдали под световым микроскопом. Положительная экспрессия E-кадгерина в желчных путях, определяемая коричневым окрашиванием, была количественно определена в желчных протоках первого и второго порядка в 10 неперекрывающихся полях зрения при 20-кратном большом увеличении (Olympus BX51, Olympus Coperation, Shinjuku-ku, Tokyo, Japan ) с помощью программы ImageJ [20].
2.11. Анализ данных

Все данные были проанализированы с использованием SPSS версии 23.0 (SPSS Inc., Чикаго, Иллинойс, США). T-критерий использовался для сравнения средних значений между двумя группами, а дисперсионный анализ (ANOVA) с апостериорным (LSD) был использован для сравнения нескольких групп. Значения p <0,05 и <0,01 считались статистически значимыми.

4. Обсуждение

Инфекция, вызываемая O. viverrini, представляет собой серьезную проблему общественного здравоохранения в Юго-Восточной Азии и часто приводит к различным гепатобилиарным патологиям, включая CCA [21].Наша группа была первой, кто описал связь между CCA и H. pylori, особенно cagA-положительной инфекцией в эндемичных для печеночных двуусток районах Таиланда [10]. Однако до недавнего времени механистическая связь между O. viverrini и H. pylori была неясной. Мы обнаружили, что O. viverrini является резервуаром H. pylori [7], а совместная инфекция этих двух патогенов может усиливать гепатобилиарные аномалии, особенно прогрессирующий перидуктальный фиброз при описторхозе и cagA-положительный H. pylori [9]. Однако механизмы, лежащие в основе усиленного канцерогенеза, остаются неуловимыми.Здесь мы показали, что O. viverrini облегчает миграцию, адгезию и колонизацию H. pylori, особенно cagA-положительный штамм. Более того, коинфекция также вызывала более тяжелую патологию желчевыводящих путей с подавлением экспрессии E-кадгерина, представляющей потенциально злокачественную трансформацию. Эти результаты значительно способствуют нашему пониманию основных механизмов и помогают прояснить, как печеночный двуусток усиливает cagA-позитивный H. pylori-индуцированный тяжелый описторхоз и CCA. H. pylori, грамотрицательная бактерия, колонизирует слизистую оболочку желудка человека и вызывает ряд желудочно-кишечных расстройств, таких как хронический гастрит, язвенная болезнь желудка, рак желудка и лимфома лимфоидной ткани, ассоциированная со слизистой оболочкой (MALT) [22,23].Помимо желудка, он был обнаружен в сердечно-сосудистой, нервной, поджелудочной и гепатобилиарной системах [24,25]. Однако механизмы, с помощью которых H. pylori мигрируют во внелудочные ткани, остаются неясными. Было предложено два возможных пути миграции в гепатобилиарную систему: (1) восходящая инфекция и (2) гематогенное распространение [26,27,28,29]. В этом исследовании мы изучили другой возможный путь миграции H. pylori в желчные протоки при совместной инфекции печеночной двуустки O.виверрини. Нам удалось обнаружить H. pylori в тегументе и кишечнике червей, а также в желчных жидкостях уже через три часа после заражения, что соответствует времени, необходимому для нормальной миграции O. viverrini в желчные протоки [12]. . Это говорит о том, что H. pylori «совмещен» и мигрирует в желчные протоки через молодых червей. Обнаружение H. pylori в крови также указывает на гематогенный путь миграции. Однако, где и как H. pylori попадает в кровоток, остается неизвестным.Восходящая инфекция через обструкцию желчных протоков маловероятна, поскольку на этой ранней стадии не развивается тяжелый перидуктальный фиброз. Тем не менее, усиление миграции H. pylori в билиарную систему может происходить во время хронической инфекции печеночного сосальщика. В этом исследовании было продемонстрировано предпочтение колонизации cagA-положительным штаммом H. pylori в желчевыводящей системе при описторхозе. Сравнивая распределение cagA-положительных и cagA-отрицательных H. pylori в желудке, крови, желчной жидкости и взрослых червях инфицированных O. viverrini хомяков, мы продемонстрировали, что штамм с низкой вирулентностью (cagA-отрицательный) легко распространяется на ранних стадиях. инфекция (один месяц), но была значительно снижена через три месяца после заражения во всех изученных местах и ​​глистах.O. viverrini, по-видимому, усиливает колонизацию cagA-отрицательных H. pylori на ранней стадии инфекции (один месяц). Однако механизм быстрого снижения cagA-отрицательного штамма при хронической инфекции неизвестен. Интересно, что в этом исследовании значительно большее количество cagA-положительных по сравнению с cagA-отрицательными H. pylori в желчной жидкости и у взрослых червей на хронической стадии (три месяца) подразумевает установление бактерий в желчевыводящей системе в O .viverrini инфекция.Эти данные подтверждают значительно более высокую частоту cagA-положительных H. pylori при описторхозе по сравнению с контролем без инфекции O. viverrini у людей [9]. Более того, наличие и специфические печеночные генотипы гена cagA H. pylori связаны с патологией хронического описторхоза, в частности перидуктальным фиброзом [9]. Генетические различия желудочных и энтерогепатических видов Helicobacter, отражающие в основном различные метаболические функции, предполагают эволюцию и адаптацию к разным хозяевам, нишам колонизации и механизмам вирулентности [30].Что касается колонизации H. pylori эпителия желчных протоков, мы обнаружили, что H. pylori выявляли только в группах коинфекции O. viverrini. Кроме того, колонизация H. pylori наблюдалась только в желчных протоках первого порядка, где встречается печеночный сосальщик, но не во вторичных желчных протоках, недоступных для червей. Эти результаты показывают, что колонизация H. pylori эпителия желчных протоков в данном исследовании зависит от O. viverrini. Этот вывод подтверждается нашими экспериментами in vitro, которые показали, что О.viverrini увеличивают связывание H. pylori с эпителиальными клетками желчных протоков H69. Более того, только cagA-положительный H. pylori был обнаружен на базолатеральной поверхности желчных клеток. Это указывает на патогенетическое значение cagA при патологии желчевыводящих путей, учитывая, что cagA-положительный, а не cagA-отрицательный штамм H. pylori способен колонизировать базолатеральные или межклеточные пространства в слизистой оболочке желудка пациентов с гастритом [31]. Однако механизмы, лежащие в основе этого явления усиленной колонизации, неизвестны.H. pylori использует многоступенчатые процессы для колонизации слизистой оболочки желудочно-кишечного тракта, включая разрушение слизистого слоя и связывание со специфическими рецепторами хозяина [32]. Идентифицировано несколько лигандов и рецепторов для связывания H. pylori; например, BabA связывается с антигенами Lewis B и Le b [33], SabA связывается с сиалил-Le x [34], в то время как связывание LPS происходит с Toll-подобным рецептором 4 (TLR4) [35, 36]. На сегодняшний день нет убедительных доказательств того, как H. pylori колонизирует желчевыводящую систему.Недавно мы сообщили, что муциназоподобный фермент является одним из наиболее распространенных белков, обнаруживаемых в экскреторно-секреторных продуктах O. viverrini [37]. Этот муциназоподобный фермент O. viverrini может разрушать или модифицировать слизистый барьер на эпителии желчных протоков и способствовать адгезии и колонизации H. pylori. Чтобы установить колонизацию в билиарной системе, адгезины H. pylori должны связываться со своими специфическими рецепторами на желчном эпителии. Хорошо известно, что холангиоциты экспрессируют множество рецепторов распознавания патогенов, включая TLR, в частности TLR4 [38] и MUC5AC, при здоровье и болезнях [39], которые являются рецепторами для H.pylori [40,41]. Учитывая, что O. viverrini может вызывать сверхэкспрессию TLR4 [42] и MUC5AC [43], печеночная двуустка может усиливать колонизацию через эти рецепторы хозяина. После колонизации H. pylori он может активировать каскады сигнальных путей, ведущих к высвобождению воспалительных цитокинов, клеточной пролиферации, трансформации и злокачественности [40,44]. В нашем исследовании с использованием модели на животных теперь сообщается, что коинфекция O. viverrini и H. pylori усиливает патологические и предопухолевые паттерны, включая метаплазию бокаловидных клеток, гиперплазию желчевыводящих путей и дисплазию.Предраковые поражения выявлялись с большей частотой в группе с коинфекцией O. viverrini и cagA-положительной H. pylori, чем в любой другой группе. Кроме того, у хомяков, которые были коинфицированы O. viverrini и cagA-положительными H. pylori, была обнаружена значительно сниженная экспрессия E-кадгерина, особенно в областях с диспластическим эпителием, по сравнению с одной инфекцией O. viverrini или с коинфекцией O. viverrini cagA. -отрицательный H. pylori. Более низкая экспрессия E-кадгерина только при инфекции O. viverrini может быть связана с выработкой интерлейкина 6 (IL-6) и TGF-β1 во время инфекции [42,45].Было показано, что IL-6 и TGF-β1, индуцируемые экскреторно-секреторными продуктами у печеночной двуустки человека, Clonorchis sinensis, подавляют экспрессию E-кадгерина [46]. Более серьезное подавление экспрессии E-кадгерина в желчном эпителии O. viverrini, коинфицированного cagA-положительным H. pylori, означает усиливающий эффект бактерий. CagA H. pylori может подавлять экспрессию E-кадгерина и участвует в дифференцировке и трансформации эпителия, что приводит к злокачественным новообразованиям [47].Пониженные уровни E-кадгерина обычно обнаруживаются в диспластической ткани и предраковых поражениях, таких как рак ротовой полости [48,49], рак желудка [50] и рак желчного пузыря [51]. В CCA снижение экспрессии E-cadherin связано с трансформацией клеток, прогрессированием опухоли, инвазией и метастазированием [52]. В целом, наши результаты согласуются с предыдущими исследованиями фактора вирулентности CagA и более высокой степени тяжести инфекции H. pylori, гастрита и канцерогенеза желудка [53,54,55,56,57].

Таким образом, это исследование является первым, которое продемонстрировало, что канцерогенный печеночный двуусток, О. виверрин, способствует миграции и колонизации H. pylori в желчных протоках. Кроме того, мы показали, что O. viverrini предпочтительно позволяет cagA-положительному штамму H. pylori колонизировать кишечник и тегумент. Результаты подтверждают мнение, что O. viverrini является резервуарным хозяином H. pylori, особенно cagA-положительного штамма. В свою очередь двуустка может постоянно выделять бактерии в желчную жидкость.Это явление позволяет этим двум канцерогенным патогенам создавать хроническую коинфекцию. Следовательно, хроническая коинфекция дополнительно усиливает канцерогенные фенотипические изменения эпителия желчных протоков, приводящие к злокачественному образованию желчных протоков. Это исследование предоставляет фундаментальную информацию для дальнейших исследований молекулярных путей канцерогенеза H. pylori и рака желчных протоков, ассоциированного с коинфекцией печеночных двуусток.

% PDF-1.4 % 1 0 объект > / Метаданные 2 0 R / PageLabels 3 0 R / Страницы 4 0 R / StructTreeRoot 5 0 R / Тип / Каталог / ViewerPreferences> >> эндобдж 6 0 obj > эндобдж 2 0 obj > транслировать 2021-08-18T17: 44: 44 + 07: 002021-08-18T17: 45 + 07: 002021-08-18T17: 45 + 07: 00Adobe InDesign 16.1 (Macintosh) uuid: b18a2e9c-e8ed-124a-be5c-955eacaeade8xmp.did: a5fe088e-6ea0-44f6-a495-c37e54a0586fxmp.id: f6f3efa0-07a2-4daa-b5bad4id-d9 aeeb-1150662a11e1xmp.did: 858ef4ca-0781-4716-9f43-8dfdfa90686fxmp.did: a5fe088e-6ea0-44f6-a495-c37e54a0586fdefault

  • преобразовано из приложения / x-indesign в приложение (Macintosh) в приложение / pdfAdoign 1617: 44: 44 + 07: 00
  • application / pdf Adobe PDF Library 15.0 Ложь конечный поток эндобдж 3 0 obj > эндобдж 4 0 obj > эндобдж 5 0 obj > эндобдж 7 0 объект > эндобдж 8 0 объект > эндобдж 9 0 объект > эндобдж 10 0 obj > эндобдж 11 0 объект > эндобдж 12 0 объект > эндобдж 13 0 объект > эндобдж 14 0 объект > эндобдж 15 0 объект > эндобдж 16 0 объект > эндобдж 17 0 объект > эндобдж 18 0 объект > эндобдж 19 0 объект > / A1> / A10> / A13> / A2> / A3> / A4> / A5> / A6> / A7> / A8> / A9> / Pa0> / Pa1> / Па2> / Pa3> / Pa4> >> эндобдж 20 0 объект > эндобдж 21 0 объект > эндобдж 22 0 объект > эндобдж 23 0 объект /Последнее изменение / NumberOfPageItemsInPage 350 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / Затенение> / XObject> >> / Повернуть 0 / StructParents 0 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 24 0 объект /Последнее изменение / NumberOfPageItemsInPage 17 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Повернуть 0 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 25 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 1 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 26 0 объект /Последнее изменение / NumberOfPageItemsInPage 26 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 2 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 27 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 8 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 28 0 объект /Последнее изменение / NumberOfPageItemsInPage 556 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / Свойства> / XObject> >> / Повернуть 0 / StructParents 9 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 29 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 10 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 30 0 объект /Последнее изменение / NumberOfPageItemsInPage 99 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 11 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 31 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 12 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 32 0 объект /Последнее изменение / NumberOfPageItemsInPage 57 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 13 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 33 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 14 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 34 0 объект /Последнее изменение / NumberOfPageItemsInPage 38 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 15 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 35 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 16 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 36 0 объект /Последнее изменение / NumberOfPageItemsInPage 119 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 17 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 37 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 18 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 38 0 объект /Последнее изменение / NumberOfPageItemsInPage 79 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 19 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 39 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 20 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 40 0 объект /Последнее изменение / NumberOfPageItemsInPage 38 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 21 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 41 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 22 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 42 0 объект /Последнее изменение / NumberOfPageItemsInPage 36 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 23 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 43 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 24 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 44 0 объект /Последнее изменение / NumberOfPageItemsInPage 58 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 25 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 45 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 26 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 46 0 объект /Последнее изменение / NumberOfPageItemsInPage 51 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 27 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 47 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 28 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 48 0 объект /Последнее изменение / NumberOfPageItemsInPage 32 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 29 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 49 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 30 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 50 0 объект /Последнее изменение / NumberOfPageItemsInPage 21 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 31 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 51 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 32 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 52 0 объект /Последнее изменение / NumberOfPageItemsInPage 321 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 33 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 53 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 34 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 54 0 объект /Последнее изменение / NumberOfPageItemsInPage 20 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 35 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 55 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 36 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 56 0 объект /Последнее изменение / NumberOfPageItemsInPage 26 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 37 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 57 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 38 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 58 0 объект /Последнее изменение / NumberOfPageItemsInPage 62 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 39 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 59 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text / ImageC] / XObject> >> / Повернуть 0 / StructParents 40 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 60 0 объект /Последнее изменение / NumberOfPageItemsInPage 9 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 41 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 61 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 42 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 62 0 объект /Последнее изменение / NumberOfPageItemsInPage 1110 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 43 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 63 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 44 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 64 0 объект /Последнее изменение / NumberOfPageItemsInPage 9 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 55 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 65 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 62 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 66 0 объект /Последнее изменение / NumberOfPageItemsInPage 8 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 71 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 67 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] >> / Повернуть 0 / StructParents 82 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 68 0 объект /Последнее изменение / NumberOfPageItemsInPage 67 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / Затенение> / XObject> >> / Повернуть 0 / StructParents 93 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 69 0 объект /Последнее изменение / NumberOfPageItemsInPage 4 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Повернуть 0 / TrimBox [0.0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 70 0 объект /Последнее изменение / NumberOfPageItemsInPage 14 / NumberofPages 1 / OriginalDocumentID / PageItemUIDToLocationDataMap> / PageTransformationMatrixList> / PageUIDList> / PageWidthList> >> >> / Ресурсы> / Шрифт> / ProcSet [/ PDF / Text] / XObject> >> / Повернуть 0 / StructParents 95 / TrimBox [0,0 0,0 419,528 595,276] / Тип / Страница >> эндобдж 71 0 объект > эндобдж 72 0 объект > эндобдж 73 0 объект > эндобдж 74 0 объект > эндобдж 75 0 объект > транслировать HW [ } _GjEA8N [! K; ی m =} ڙ u $ r # pyo8 {8P͇A4QçWw /> / yOM! (S2 / ~ d 鳯 M 7Ǜ˷ 滯 l {붿 [3dn _ (} (Y Т 삹} sWo + v? | E 佻 ɧorq ^ 4x) ++> g93 + 1jĜu \ dKPzє 6 + ǻWRw?]! ˏmII * w & ;; gKK, m ޘ ݿ 5> ޽ UE7t6Pz ޑ x45 [Дж% 22 }? + G ߫ Zu’Yg΁ {6, ޒ * [q \ JDMlx6fS2 \ Jqö8l 坟 ҅)] x ||| Bh0TE @ 5Ӕ.

    Leave a Comment

    Ваш адрес email не будет опубликован.