17 б эстрадиол: (Oestradiolum)- , , , .

Содержание

Эстрадиол

Эстрадиол – это эстрогенный стероидный гормон, вырабатывающийся в яичниках, плаценте, коре надпочечников, периферических тканях и семенниках у мужчин. Играет важную роль в правильном формировании и функционировании половой системы.

Синонимы русские

Е2.

Синонимы английские

Estradiol, 17-beta-estradiol, E2.

Метод исследования

Электрохемилюминесцентный иммуноанализ (ECLIA).

Диапазон определения: 5 — 30000 пг/мл.

Единицы измерения

Пг/мл (пикограмм на миллилитр).

Какой биоматериал можно использовать для исследования?

Венозную кровь.

Как правильно подготовиться к исследованию?

  1. Не принимать пищу в течение 2-3 часов до исследования, можно пить чистую негазированную воду.
  2. Прекратить прием стероидных и тиреоидных гормонов за 48 часов до исследования (по согласованию с врачом).
  3. Исключить физическое и эмоциональное перенапряжение в течение 24 часов до исследования.
  4. Не курить 3 часа до исследования.

Общая информация об исследовании

Эстрадиол относится к группе эстрогенных стероидных гормонов и является одним из наиболее распространенных и активных из них. Он играет важную роль в регуляции менструального цикла и функционировании женской половой системы.

Эстрадиол отвечает за развитие женских половых органов и вторичных половых признаков и влияет на менструальный цикл и беременность. Он считается основным половым гормоном у женщин и присутствует в небольших количествах у мужчин. Это один из основных эстрогенов у небеременных женщин.

Он производится в основном в яичниках, а также дополнительно в надпочечниках у женщин и в яичках и надпочечниках у мужчин.

У женщин в период менструального цикла уровень эстрадиола изменяется в течение месяца, поднимаясь и опускаясь согласованно со стимуляцией фолликулов в яичниках фолликулостимулирующим гормоном, лютеинизирующим гормоном и прогестероном, во время выхода яйцеклетки и готовности матки к потенциальной беременности. Уровень эстрадиола самый низкий в начале менструального цикла, а его подъем до самой высокой отметки как раз приходится на выпуск яйцеклетки из яичника (овуляцию). Нормальный уровень эстрадиола позволяет обеспечить надлежащую овуляцию, оплодотворение яйцеклетки и протекание беременности, а также здоровую структуру костей и нормальное содержание холестерина.

Для чего используется исследование?

  • Определение уровня эстрадиола используется для оценки функции яичников.
  • Для диагностики раннего (преждевременного) полового созревания у девочек и гинекомастии у мужчин.
  • Для выявления причин аменореи (например, чтобы определить, вызвана она беременностью или заболеванием).
  • Для контроля за развитием фолликула в яичнике в дни, предшествующие экстракорпоральному оплодотворению (во вспомогательных репродуктивных технологиях).

Когда назначается исследование?

  • Женщинам при тазовых болях, аномальных вагинальных кровотечениях, нарушениях менструального цикла, бесплодии, а также когда развитие половых органов происходит раньше или позже, чем должно.
  • При симптомах менопаузы: приливах, ночной потливости, бессоннице и/или аменорее.
  • Если у женщины проблемы с зачатием (для контроля за степенью роста того или иного фолликула и последующего экстракорпорального оплодотворения).
  • При симптомах феминизации у мужчин, таких как гинекомастия, которые могут быть вызваны эстрогенсекретирующей опухолью.

Что означают результаты?

Референсные значения

 

Фаза цикла, беременность

Эстрадиол, пг

л

Женщины

Фолликулиновая

12,4 — 233

Овуляторная

41 — 398

Лютеиновая

22,3 — 341

Постменопауза

1-й триместр

154 — 3243

2-й триместр

1561 — 21280

3-й триместр

8525 — 30000

Мужчины

 

11,26 — 43,25

Необходимо внимательно относиться к интерпретации результатов, потому что концентрация эстрадиола меняется каждый день на протяжении менструального цикла. Врач, следящий за уровнем гормонов у женщины, должен учитывать тенденции его изменений, повышение или снижение в связи с менструальным циклом или беременностью, а не оценивать отдельные значения. Результаты анализа не являются специфичными, но дают врачу дополнительную информацию о возможной причине развития тех или иных симптомов у пациента.

Причины снижения уровня эстрадиола

  • Синдром Шерешевского – Тернера – хромосомная болезнь, сопровождающаяся аномалиями физического развития, низкорослостью и половым инфантилизмом.
  • Гипопитуитаризм (болезнь Симмондса, синдром Шиена) – снижение концентрации циркулирующих гипофизарных гормонов с последующим развитием гипофункции и атрофии надпочечников, щитовидной и половых желез.
  • Гипогонадизм – это снижение функции яичников из-за их врождённого недоразвития или повреждения во младенчестве.
  • Нервная анорексия, проявляющаяся у женщин аменореей.
  • Синдром поликистозных яичников (синдром Штейна – Левенталя) – полиэндокринный синдром, сопровождающийся нарушениями функции яичников (отсутствием или нерегулярностью овуляции, повышенной секрецией андрогенов и эстрогенов), поджелудочной железы, коры надпочечников, гипоталамуса и гипофиза.
  • Экстремальные упражнения на выносливость.
  • Постменопауза.

Причины повышения уровня эстрадиола

  • Раннее половое созревание.
  • Гинекомастия – доброкачественное увеличение грудной железы у мужчин с гипертрофией жировой ткани.
  • Опухоли яичников, яичек или надпочечников.
  • Гипертиреоз – увеличение преобразования андрогенов в эстрогены в тканях и повышение уровня циркулирующего глобулина, связывающего половые гормоны, из-за чего возрастает соотношение эстрогенов к андрогенам.
  • Цирроз печени.

Что может влиять на результат?

  • Глюкокортикостероиды, ампициллин, эстрогенсодержащие препараты, фенотиазины, тетрациклины способны повышать уровень эстрадиола.
  • Употребление травы каскары саграды иногда приводит к ложнозавышенным результатам данного анализа.
  • Диета с высоким содержанием углеводов и низким содержанием жиров, как у вегетарианцев, может понизить уровень эстрадиола.

Эстрадиол, сдать анализ на эстрадиол (E2, Estradiol)

Метод определения Твёрдофазный хемилюминесцентный иммуноанализ.

Исследуемый материал Сыворотка крови

Доступен выезд на дом

Онлайн-регистрация

Синонимы: Анализ крови на эстрадиол. 17-beta-estradiol. 

Краткая характеристика определяемого вещества Эстрадиол 

Эстрадиол – стероидный гормон с максимальной эстрогенной активностью. Циркулирует в крови большей частью в комплексе с глобулином, связывающим половые гормоны (см. тест № 149). У женщин вырабатывается преимущественно в яичниках, а также в сетчатой зоне коры надпочечников, в небольших количествах образуется в ходе периферического преобразования андрогенных гормонов. Контроль секреции осуществляется фолликулостимулирующим гормоном (см. тест № 59), лютеинизирующим гормоном (см. тест № 60) и пролактином (см. тест № 61). Во время беременности активирующее воздействие на синтез эстрадиола оказывает хорионический гонадотропин. У мужчин эстрадиол образуется в семенниках, коре надпочечников, значительная часть – в периферических тканях за счет преобразования андрогенов. Суточные колебания концентрации эстрадиола в сыворотке крови связаны с ритмом секреции ЛГ: максимум приходится на период с 15 до 18 часов, а минимум – между 24 и двумя часами ночи. В детском возрасте эстрадиол секретируется в незначительных количествах, его содержание нарастает во время пубертата. У женщин детородного возраста уровень эстрадиола в сыворотке и плазме крови зависит от фазы менструального цикла. Наблюдается медленный рост в начале цикла, с максимальным уровнем в позднюю фолликулярную фазу. Овуляция наступает через 24-36 часов после возникновения надпорогового уровня эстрадиола. После овуляции уровень гормона снижается, возникает второй, меньший по амплитуде, подъем и далее спад, продолжающийся до конца лютеиновой фазы. Во время беременности концентрация эстрадиола в сыворотке и плазме крови нарастает к моменту родов, после родов возвращается к норме на четвертый день. С возрастом у женщин наблюдается снижение концентрации эстрадиола, в постменопаузу его концентрация снижается до уровня, наблюдаемого у мужчин. В женском организме эстрадиол обеспечивает формирование половой системы по женскому типу, развитие женских вторичных половых признаков в пубертатном периоде, становление и регуляцию менструальной функции, обеспечивает формирование подкожной жировой клетчатки по женскому типу. Эстрадиол связан с формированием психофизиологических особенностей женского полового поведения, для проявления этих эффектов эстрадиола существенным является его соотношение с тестостероном (см. тест № 64). Эстрадиол оказывает выраженное влияние на содержание плазматических белков, в том числе транспортных (ГСПГ, кортикостероидсвязывающего глобулина, тироксинсвязывающего глобулина), что объясняет наблюдаемый при беременности рост концентрации в плазме гормонов, транспортируемых этими белками. Под влиянием эстрогенов повышается концентрация белков, связывающих медь и железо, липопротеинов высокой плотности, усиливается свертывающая способность крови. Они оказывают действие на обмен костной ткани, ускоряют линейный рост у девочек, снижают костную резорбцию. На уровне почек эстрогены способствуют задержке натрия и воды в организме. Исследование эстрадиола применяют для оценки функции яичников, диагностики нарушений метаболизма стероидов, контроля гормональной терапии. 

С какой целью определяют уровень Эстрадиола в сыворотке крови 

Определение уровня эстрадиола применяют для оценки функции яичников при нарушениях менструального цикла у женщин, а также при женском и мужском бесплодии, для выявления нарушений метаболизма стероидов, контроля гормональной терапии. Также возможно использовать этот тест в диагностике опухолей, вырабатывающих эстрогены, и при подозрении на нарушения метаболизма стероидов.

Ovariectomy and 17β-estradiol Replacement in Rats and Mice: A Visual Demonstration

Администрация режимах приведенные выше есть в более ранних исследованиях доказал свое превосходство в коммерческих медленного высвобождения гранул и инъекций по производству физиологических сывороточных концентраций 17β-эстрадиол. Хотя медленным высвобождением гранулы производят очень высокой и длительной концентрации сывороточного пика, инъекции приводят к крайности, суточные колебания гормонов и требуют повторяющихся стрессовых обработка животных 4-6. Важность выбора адекватного режима администрации подчеркнули последние исследования показывают, что в то время как низкие дозы 17β-эстрадиол администрации схем (например, методы, представленные в данной статье), защиты от церебральной ишемии 8-10, 17β-эстрадиола концентрации производства коммерческие медленного высвобождения гранул может фактически увеличить повреждения головного мозга 1,2,11-14. Питьевая вода администрации и устные зонд два других, менее часто, методы, которые были протестированы. Администрирование гормоны через питьевую воду имеет наибольшую выгоду в том, крайне неинвазивным, так как почти ни одно животное обработки вообще не требуется. Тем не менее, 17β-эстрадиол не растворяется в воде без эмульгатора, отдельных водозаборов трудно контролировать, и если цель состоит в том, чтобы отразить потребления таблетки, еще один недостаток в том, что мышей пить воду в течение всего 24 часов . Устные зонд имеет наибольший недостаток в том, что это стресс для животного, и может вызвать повреждение пищевода, которые могут влиять на пищевое поведение.

Методы, описанные здесь — силиконовые капсулы и пероральный Nutella — оба подходят для коротких администрация эстрогена срок и на более длительные сроки до 5-6 недель. Если высокие дозы используются, чем описанные выше, независимо от типа управления среды, долгосрочного эстрогенов может вызвать серьезные побочные эффекты, такие как закупорка уретры из-за слизистой пролиферацию 15.

«> Методы, представленные здесь, могут быть легко изменены в отношении дозировки, длина капсулы и т.д. Например, это может быть оправдано, чтобы снизить и 17β-эстрадиола дозах и в капсулах и Nutella у мышей схемы более стабильно достижения физиологической сыворотке 6. Однако, если вносятся изменения, или если методы, используемые в других штаммов животных, чем уже исследованы, крайне важно, чтобы проверить методы измерения заново 17β-эстрадиола концентрации в сыворотке крови. Эти образцы сыворотки должен быть получен в несколько раз точки, чтобы отразить весь доза-ответ / кривой, а не просто короткий проблеск. матки весов были использованы некоторые авторы вместо сыворотки 17β-эстрадиола концентрации как мера биологические эффекты 17β-эстрадиол. Тем не менее, очевидно, веса матки отражает специфическое воздействие эстрогенов на эндометрий и не обязательно отражают влияние эстрогенов на других системах. Furtее вес матки слабо коррелирует с уровнем эстрогена сыворотки 4,6.

Ежедневное употребление больших количеств богатых энергией Nutella может привести к увеличению веса. Тем не менее, небольшое количество описанных выше только соответствует менее чем 5% животных, ежедневное потребление энергии и чрезмерное увеличение веса не наблюдается в наших исследованиях с использованием Nutella.

Принципиальная разница в работе с крысами и мышами заслуживает особого внимания. Несмотря на строгие гигиенические имеет решающее значение, независимо от вида животных, мышей чувствительность к инфекции, требует проверки на более высокий уровень, чем при работе с крысами. Например, осторожно дезинфекции кожи перед разрезом, частая смена медицинских перчаток и использования стерильных хирургических инструментов не должна быть нарушена. Имплантаты всегда очагов инфекций. Животные Поэтому необходимо регулярно проверяется на наличие признаков инфекции после имплантации капсул. Если абсцесс формируется вокругимплантата, мы рекомендуем, чтобы животное усыпляют или что капсула удаляется, рана тщательно очищены, а другая капсула восстановлена ​​через новый разрез. Кроме того, кожа на спине мышей гораздо более хрупкие, чем у крыс, требующих двух недель выздоровления после овариэктомии до капсулы администрации.

Методы, представленные выше, могут также быть использованы для других веществ, чем 17β-эстрадиол. Тем не менее, важно, что фармакокинетика и дозы каждый режим тщательно характеризуется, предпочтительно последовательно сыворотки измерения вводят вещества.

Subscription Required. Please recommend JoVE to your librarian.

Эстрадиол (Estradiol, Е2) Анализ крови на эстрадиол в

Предел аналитической чувствительности тест-системы ARCHITECT Estradiol стоставляет 37 пмоль/л. При концентрации эстрадиола ниже предела аналитической чувствительности, результат будет выдан в формате «

Референсные значения (вариант нормы):

Возраст, годы Мужчины Возраст, годы Женщины Единицы измерения
15дн–1год <92 15дн–1год <92 пмоль/л
1–11 <46 1–11 <37
11–13 <95 11–12 <176
13–15 <102 12–14 39–631

Интерпретация полученного результата зависит от стадии полового развития. При наличии регулярного менструального цикла: 

  • фолл. фаза: 77–921 
  • овул. пик: 140–2371 
  • лют. фаза: 77–1145
15–19 <141 14–19 <939

Интерпретация полученного результата зависит от стадии полового развития. При наличии регулярного менструального цикла: 

  • фолл. фаза: 77–921 
  • овул. пик: 140–2371 
  • лют. фаза: 77–1145
>19 40–162 >19

Интерпретация полученного результата зависит от стадии полового развития. При наличии регулярного менструального цикла: 

  • фолл. фаза: 77–921 
  • овул. пик: 140–2371 
  • лют. фаза: 77–1145 
  • менопауза (на ГЗТ) до 529 
  • менопауза (без ГЗТ) до 103

При интерпретации результатов исследования необходимо учитывать, что уровень эстрадиола изменяется каждый день на протяжении менструального цикла.

Повышение значений Снижение значений
  • Гинекомастия
  • Маточные кровотечения в период менопаузы
  • Эстрогенпродуцирующие опухоли
  • Цирроз печени
  • Лекарственные препараты (кломифен, тамоксифен, гонадотропины)
  • Синдром Тернера
  • Гипогонадизм (первичный и вторичный)
  • Лекарственные препараты (17α-эстрогены)

Обращаем Ваше внимание на то, что интерпретация результатов исследований, установление диагноза, а также назначение лечения, в соответствии с Федеральным законом № 323-ФЗ «Об основах охраны здоровья граждан в Российской Федерации» от 21 ноября 2011 года, должны производиться врачом соответствующей специализации.

Сдать анализы на гормон 17-гидроксипрогестерон (17-ОПГ) в Ростове-на-Дону

Гидроксипрогестерон необходим человеческому организму для синтеза гормонов (кортизол, тестостерон и эстрадиол). Из них особую роль играет кортизол: он участвует в расщеплении углеводов, белков и жиров, а также регулирует давление крови и работу иммунной системы. В лабораторных исследованиях гормон 17 гидроксипрогестерон нужен для наблюдения за работой надпочечников и выявления рисков неправильного развития плода у беременных женщин.

В каких случаях назначают исследование?

Анализ на 17 опг назначают в следующих случаях:

  1. Во время профосмотров новорожденных детей. Анализ повторяют, если выявлены отклонения от нормы. Также исследования нужны при неправильной работе надпочечников у детей. Заболевание характеризуется вялостью, слабостью, обезвоживанием, пониженным давлением крови, отказами от еды.

  2. Обнаружена врожденная патология надпочечников (гиперплазия), что приводит к нарушениям в развитии половых органов и/или вторичных половых признаков.

  3. При выявлении отклонений в женском организме: гирсутизм, нерегулярный месячный цикл, невозможность иметь детей (признаки схожи с заболеваниями яичников).

  4. Если в организме обнаружено недостаточное количество фермента 21-гидроксилазы. Исследование необходимо для определения эффективности назначенного лечения.

Особенно важно, определять норму 17 гидроксипрогестерон у женщин для обнаружения возможных рисков в работе половых органов.

Подготовка

Перед тем, как сдать анализ на 17 гидроксипрогестерон, необходимо выполнить условия:

  • отказаться от еды за два-три часа до анализа, можно выпить простой воды без газа;

  • женщинам важно учитывать менструальный цикл (анализ сдается на 3-5 день цикла), рекомендуется проконсультироваться с врачом.

Где сдать анализ на 17 ОПГ в Ростове?

Для того чтобы сдать анализ на 17 гидроксипрогестерон в Ростове, можно обратиться в наш медицинский центр.

Профессионально подготовленный медицинский персонал сделает процедуру качественно, с соблюдением всех правил.

Вопросы по проведению исследования можно задать по телефону или во время обращения в наш медцентр.

  • Наименование услуги

    Цена

Отзывы об услуге

Эстрадиол — обзор | Темы ScienceDirect

3.18.3.2.1.1 Эстрадиол

Эстрадиол играет решающую роль в обеспечении гомеостатической отрицательной обратной связи по высвобождению GnRH / LH как у мужчин, так и у женщин. Более того, у женщин реакция на обратную связь по эстрадиолу периодически переключается на положительную, вызывая преовуляторный всплеск GnRH / LH (см. Christian and Moenter, 2010 для дальнейшего обзора механизмов всплеска). Явная потребность в эстрадиоловой обратной связи для правильной регуляции функции оси HPG и фертильности привела к усилению интереса к механизмам передачи сигналов эстрадиола и влиянию на функцию нейронов GnRH.Эстрадиол, вероятно, действует как непосредственно на нейроны GnRH через β-изоформу рецептора эстрадиола (ERβ) (Skynner et al., 1999; Hrabovszky et al., 2000, 2001; Herbison and Pape, 2001; Chu et al., 2009), и косвенно через вышестоящие клетки, которые экспрессируют рецептор эстрадиола α (ERα) и / или ERβ (Flugge et al., 1986; Leranth et al., 1991; Pompolo et al., 2003; Eyigor et al., 2004; Wintermantel et al. , 2006).

Одной из моделей, которая широко использовалась в последние 10 лет в этом отношении, является овариэктомия мышей с одновременной заменой высоких физиологических уровней эстрадиола (имитирующих циркулирующие концентрации в проэструсе до овуляции) через подкожную капсулу (Christian et al., 2005). В этой модели, как и ранее на крысах и хомяках (Norman and Spies, 1974; Legan and Karsch, 1975), наблюдаются ежедневные переключения с отрицательной обратной связи по эстрадиолу в начале дня на положительные эффекты обратной связи вечером, вызывая выброс ЛГ. во время выключения света в течение 5 дней после операции. Почти постоянный уровень циркулирующего эстрадиола означает, что его можно рассматривать как модель с одной переменной, в которой единственной переменной является время суток, что облегчает прямые сравнения и оценку механистических изменений, отражающих состояния отрицательной и положительной обратной связи.Кроме того, изменения ЛГ напрямую коррелируют с подавлением активности нейронов гонадолиберин, что регистрируется на острых срезах головного мозга во время отрицательной обратной связи, и устойчивыми уровнями активности во время всплеска (Christian et al., 2005), что указывает на то, что ключевые и достаточные части механизма обратной связи по выбросам сохраняются в препарате среза головного мозга. Оба эти состояния обратной связи, по-видимому, основаны на классической передаче сигналов ERα (т.е. через активацию геномных элементов ответа на эстроген) (Christian et al., 2008) в афферентных нейронах, которые синапсируют с нейронами GnRH (Christian, Moenter, 2007; Christian et al., 2009). Другие исследования, проведенные более чем через 5 дней после овариэктомии и замещения эстрадиола, показали, что лечение эстрадиоловой обратной связью привело к увеличению времени покоя нейронов ГнРГ (т. Е. Практически без возбуждения) и увеличению времени между вспышками возбуждения потенциала действия. без изменения профиля самих всплесков (Nunemaker et al., 2002, 2003b). Также было показано, что эстрадиол оказывает негативное влияние на активацию нейронов GnRH у самцов мышей, что в первую очередь отражается на изменениях в характере активности (Pielecka and Moenter, 2006).

Вышеупомянутые исследования изучали эффекты эстрадиола, вводимого in vivo , на активность нейронов GnRH, зарегистрированных in vitro . Введение эстрадиола (или агонистов рецептора эстрадиола) in vitro также использовалось для исследования быстрого действия эстрадиола на активность нейронов ГнРГ. Быстрые эффекты острого применения эстрадиола на нейроны GnRH мышей и приматов, по-видимому, зависят от концентрации. Когда использовались низкие физиологические уровни (низкий диапазон пМ), активность нейронов ГнРГ подавлялась ERα-зависимым образом, вероятно, опосредованно транссинаптически, тогда как высокие физиологические уровни (100 пМ – 100 нМ) стимулировали активность нейронов ГнРГ непосредственно через ERβ (Chu et al. ., 2009). Точно так же 1 нМ эстрадиола может стимулировать возбуждение культивируемых эмбриональных нейронов GnRH приматов (Abe and Terasawa, 2005). Эти результаты контрастируют с предыдущими исследованиями, демонстрирующими острую гиперполяризацию нейронов ГнРГ морских свинок под действием 10–100 нМ эстрадиола (Kelly et al., 1984; Lagrange et al., 1995). Это несоответствие может отражать видовые различия внутриклеточных механизмов и / или подтипов рецепторов, задействованных различными концентрациями эстрадиола. Эстрадиол может также задействовать связанный с мембраной G-белок-связанный рецептор 30 (GPR30), чтобы опосредовать быстрые возбуждающие эффекты на нейроны GnRH (Noel et al., 2009). В качестве альтернативы, реакция любого заданного нейрона ГнРГ на быстрое применение эстрадиола может отражать состояние активности этой клетки во время применения эстрадиола, что продемонстрировано одновременной записью переходных процессов внутриклеточного кальция и возбуждающей активности нейронов ГнРГ (Romano and Herbison, 2012). . В целом, хотя реакция на быстрое действие эстрадиола может быть разной из-за множества факторов, эти исследования демонстрируют, что в дополнение к классическому действию эстрадиола, требующему более длительного периода времени, нейроны ГнРГ также очень чувствительны к быстрым эффектам.Это может иметь важное значение для понимания эффектов эстрадиола, синтезированного de novo в головном мозге, по сравнению с эффектами эстрадиола, полученного из гонад. Для дальнейшего обсуждения быстрых эффектов эстрогенов см. Главу 3.01 «Мембранные эффекты эстрадиола на центральную нервную систему».

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Набор для ИФА 17 бета-эстрадиола (ab108667)

Обзор

  • Название продукта

    Набор для ИФА 17 бета-эстрадиола

  • Метод обнаружения

    Колориметрический

  • Точность

    Интра-анализ
    Образец n Среднее SD CV%
    Всего 20
    Между анализами
    Образец n Среднее SD CV%
    Всего 3
  • Тип образца

    Моча, сыворотка, плазма гепатита, плазма с ЭДТА, плазма Cit

  • Тип анализа

    Конкурсные

  • Чувствительность

    8.68 пг / мл

  • Диапазон

    20 пг / мл — 2000 пг / мл

  • Восстановление

  • Продолжительность анализа

    Многоступенчатый стандартный анализ

  • Активность видов

    Реагирует с: Mouse, Rat, Human
    Предполагается, что будет работать с: Млекопитающие
  • Обзор продукции

    Набор

    Abcam. 17-бета-эстрадиол in vitro -конкурентный ELISA (иммуноферментный анализ) разработан для точного количественного измерения 17-бета-эстрадиола в сыворотке и плазме (цитрат).

    96-луночный планшет был предварительно покрыт антиэстрадиоловым IgG. Образцы и конъюгат эстрадиол-HRP добавляют в лунки, где эстрадиол в образце конкурирует с добавленным эстрадиол-HRP за связывание антител. После инкубации лунки промывают для удаления несвязанного материала и затем добавляют субстрат TMB, который катализируется HRP для получения синей окраски. Реакцию прекращают добавлением стоп-раствора, который останавливает развитие цвета и вызывает изменение цвета с синего на желтый.Интенсивность сигнала обратно пропорциональна количеству эстрадиола в образце, и интенсивность измеряется при 450 нм.

  • Платформа

    Микропланшет

Недвижимость

  • Инструкция по хранению

    Хранить при + 4 ° C. См. Протоколы.

  • Компоненты 1 x 96 тестов
    Промывочный раствор 10X 1 x 50 мл
    17 beta Estradiol Control 1 х 0.5 мл
    17 бета-эстрадиол Стандартный 0 1 x 1 мл
    17 бета-эстрадиол Стандарт 1 (20 пг / мл) 1 x 0,5 мл
    17 бета-эстрадиол Стандарт 2 (120 пг / мл) 1 x 0,5 мл
    17 бета-эстрадиол Стандартный 3 (300 пг / мл) 1 x 0,5 мл
    17 бета-эстрадиол Стандарт 4 (600 пг / мл) 1 х 0.5 мл
    17 бета-эстрадиол Стандартный 5 (2000 пг / мл) 1 x 0,5 мл
    Конъюгат 17 бета-эстрадиол-HRP 1 x 22 мл
    Микропланшет, покрытый анти-17 бета-эстрадиолом IgG (12 x 8 лунок) 1 шт.
    Покровная пленка 1 шт.
    Стоп-раствор 1 x 15 мл
    Держатель ленты 1 шт.
    TMB Substrate Solution 1 x 15 мл
  • Направления исследований

Изображения

  • Биологические жидкости для ab108667

    17 бета-эстрадиол, измеренный в биологических жидкостях, показывает количество (пг) на мл исследуемой пробы.Образцы разбавляли в 1-2 раза.

  • Типичная стандартная кривая

    с использованием ab108667

Таблицы данных и документы

  • SDS скачать

    Страна / регион Выберите страну / регион

    Язык Выбор языка

  • Скачать брошюру

Список литературы (33)

ab108667 упоминается в 33 публикациях.

  • Лю X и др. Ось AMPK-mTOR требует повышенной экспрессии MALAT1 для стимуляции пролиферации гранулезных клеток при эндометриозе. Exp Ther Med 21:21 (2021). PubMed: 33235630
  • Grabrucker S et al. Активация медиальной преоптической области (MPOA) улучшает потерю материнского поведения на мышиной модели Shank2 для аутизма. EMBO J 40: e104267 (2021 г.). PubMed: 334

  • Bosiacki M et al. Концентрации Ca, Mg, P, простагландина E2 в костях и паратироидном гормоне; 1,25-дигидроксивитамин D3; 17-бета-эстрадиол; Тестостерон и соматотропин в плазме стареющих крыс, подвергшихся физическим тренировкам в холодной воде. Биомолекулы 11: Н / Д (2021 г.). PubMed: 33919152
  • Goyal A & Garabadu D Винпоцетин усиливает антиамнестическую активность альфа-агониста эстрогеновых рецепторов у животных, подвергшихся двусторонней овариэктомии. Behav Brain Res 393: 112789 (2020). PubMed: 32593544
  • Asperger H et al. Компонент 1 мембраны рецептора прогестерона регулирует гомеостаз липидов и управляет онкогенной передачей сигналов, что приводит к прогрессированию рака груди. Рак молочной железы Res 22:75 (2020). PubMed: 32660617
Посмотреть все публикации для этого продукта

Мнения клиентов, вопросы и ответы

1 4 из 4 Обзоры или вопросы и ответы

Просмотров: 10Просмотров: 50Просмотров: 100Сортировать по: Наивысшим голосам Сортировать по: Наименьшим голосам Сортировать по: Новейшим Первым Сортировать: Старым Первым

Мне нравятся эти комплекты от Abcam, потому что они просты в использовании и имеют очень хорошую инструкцию производителя.В комплект входит все необходимое (см. Рисунок), а лунки для полосок очень хороши, чтобы максимизировать экспериментальные условия и повторить анализ в другой день. Набор позволяет получить результат за 3 часа, что, в частности, отлично подходит для обучения. Я определенно рекомендую этот комплект.

Сообщество пользователей Abcam

Проверенный клиент

Отправлено 27 авг.2014 г.

Я дважды пробовал использовать этот набор, чтобы определить уровень эстрогена у мышей.В первый раз многие из моих образцов вышли за пределы допустимого диапазона, поэтому я попытался оптимизировать, оставив образцы на ночь и снизив свои стандартные значения, чтобы лучше оценить более низкие концентрации. Однако оказалось, что уровни эстрогена у мышей слишком низкие, чтобы их можно было определить с помощью этого набора. Мои самые высокие значения наблюдались у моих самок мышей, перенесших овариэктомию (образцы F ovx) за 5 недель до тестирования их плазмы — я ожидал, что эти уровни будут почти нулевыми. Хотя я уверен, что этот набор подходит для людей, я не рекомендую использовать его для мышей, которые не находятся в тепле.Я приложил свои графические данные. Обозначение M: самцы мышей, F: самки мышей, F (ovx): овариэктомированные мыши, F Sham: самки мышей, перенесших фиктивную операцию. 2 часа означает, что образец оставляли на 2 часа, ON означает, что образец инкубировали в течение ночи.

Сообщество пользователей Abcam

Проверенный клиент

Отправлено 20 авг.2014 г.

Рекомендуется использовать компонент набора «Эстрадиол 17-бета Стандарт 0» для разбавления ценных образцов.Стандарт готовят из сыворотки без бета-эстрадиола 17. В качестве альтернативы следует использовать сыворотку от мужчин, не содержащую эстрадиола, в качестве основы для разбавления высоких образцов. Использование PBS / 1% BSA не имитирует образцы матрикса или сыворотки и может привести к недостоверным результатам.

Подробнее

Наш иммуноферментный анализ на 17 бета-эстрадиолов ab08667 представляет собой конкурентный иммуноферментный анализ.Следовательно, можно было бы ожидать обратной зависимости между поглощением и концентрацией.

Подробнее

Зависящие от времени и дозы эффекты 17-бета-эстрадиола на кратковременную пролиферацию и экспрессию генов в клетках гранулезы свиней в реальном времени клеток гранулезы (ГК) во время фолликулогенеза, оогенеза и созревания ооцитов.Хотя роль 17-бета-эстрадиола (E2) в активности яичников широко известна, его влияние на пролиферативную способность, образование соединений щелевых соединений (GJC) и трансформацию GCs-лютеиновых клеток требует дальнейших исследований. Таким образом, целью данного исследования было оценить в реальном времени пролиферативную активность ГК свиней in vitro в отношении экспрессии коннексина (Сх), рецептора лютеинизирующего гормона (LHR), рецептора фолликулостимулирующего гормона (FSHR) и ароматазы (CYP19A1). во время кратковременного (168 ч) первичного культивирования.Культивированные GC подвергали острому (через 96 ч культивирования) и / или длительному (от 0 до 168 ч культивирования) введению 1,8 и 3,6

мк M E2. Измеряли относительное содержание мРНК Cx36, Cx37, Cx40, Cx43, LHR, FSHR и CYP19A1. Мы пришли к выводу, что способность GCs к пролиферации in vitro в значительной степени связана с экспрессией Cxs, LHR, FSHR и CYP19A1. Кроме того, трансформация GC-лютеиновых клеток in vitro может в значительной степени сопровождаться пролиферативной активностью GC у свиней.

1. Введение

Правильное развитие ооцитов млекопитающих зависит от двунаправленной коммуникации через щелевые соединения (GJC), происходящие между женской гаметой и окружающими соматическими кучевыми клетками (CCs) [1]. Хорошо известно, что коннексины (Cxs) являются основными маркерами взаимодействия кумулюсных клеток и ооцитов и, следовательно, играют решающую роль в двунаправленном транспорте малых молекул между этими клетками [2]. Более того, недавно было сообщено, что коннексин 43 (Сх43) играет критическую роль в этой коммуникации и может быть признан маркером созревания ооцита [3].Эта паракринная ассоциация определяет правильное созревание ооцитов и достижение стадии MII. Было показано, что GJC ответственны за правильный рост ооцитов; однако до сих пор не совсем известно, как эти коммуникации влияют на дифференцировку и пролиферацию гранулезно-кумулюсных клеток in vitro.

До сих пор имеется немного сообщений, указывающих на способность клеток гранулезы (ГК) пролиферировать in vitro. Недавно мы показали, что клетки кумулюса пролиферируют in vitro в культуральных моделях, окруженных и разделенных кумулюсом [4].Более того, субклеточное распределение маркеров созревания, Cdk4 и Cx43, значительно отличается в фолликулах различного размера и условий культивирования. Кратковременная пролиферация CC in vitro существенно влияет на экспрессию белков Cdk4 и Cx43, а также на их ядерную и цитоплазматическую локализацию. Однако молекулярный фактор, определяющий способность к пролиферации GC in vitro, а также трансформация GC-лютеиновых клеток, связанная с субклеточным распределением маркерных белков, все еще требует дальнейшего изучения.

Хорошо известно, что яичник млекопитающих выполняет две важные функции: производство женских гамет и синтез стероидных гормонов яичников, таких как эстроген и прогестерон. Оба эти гормона участвуют в гормональных путях обратной связи, которые регулируют рост и дифференцировку фолликулярных клеток. Более того, это хорошо известная теория, согласно которой способность яичников синтезировать 17-бета-эстрадиол (E2) является основным показателем правильной функции и активности фолликулов яичников. Андрогены, продуцируемые в слоях клеток теки путем преобразования, используются в синтезе эстрогена в клетках гранулезы.Более того, ГК продуцируют эстроген, и воздействие экзогенного эстрогена из-за введения E2 может вызвать отрицательную обратную связь эстрогена в клетках гранулезы [5].

Поскольку было обнаружено, что E2 активно синтезируется в GCs, предполагается, что E2 может играть важную роль в пролиферации GC и дифференцировке GC-CC [6]. Однако связь экспрессии Cxs с пролиферацией GCs in vitro в среде, дополненной E2, до сих пор полностью не выяснена. Таким образом, это исследование было направлено на изучение пролиферации GC свиней в реальном времени после обработки E2 в отношении экспрессии гена Cxs, обращаясь к роли связи GJC в пролиферации в реальном времени обработанных E2 GCs свиньи.

2. Материалы и методы
2.1. Животные

В этом исследовании было использовано 40 пубертатных помесных свинок породы ландрас, выращенных на местной коммерческой ферме. Их средний возраст составлял 155 дней (диапазон: 140–170 дней) и средний вес 100 кг (95–120 кг). Все животные содержались в одинаковых условиях и получали один и тот же корм (в зависимости от возраста и репродуктивного статуса). Эксперименты были одобрены Локальным этическим комитетом.

2.2. Сбор яичников свиней и культивирование in vitro клеток гранулезы свиней (GCs)

Яичники и репродуктивные тракты были получены во время убоя и доставлены в лабораторию в течение 40 минут при 38 ° C в условиях 0.9% NaCl. Для обеспечения оптимальных условий яичники каждого животного помещали в 5% фетальную бычью сыворотку (FBS; Sigma-Aldrich Co., Сент-Луис, Миссури, США) в PBS [7, 8]. Клетки гранулезы собирали путем аспирации фолликулярной жидкости из отдельных фолликулов с помощью иглы 20 G. Собранные клетки дважды промывали центрифугированием при 200 × g в течение 10 мин при комнатной температуре с культуральной средой. КОК удаляли из клеточной суспензии фильтрованием через сетчатый фильтр для клеток 40 мкм мкм и выбрасывали. Среда состояла из среды Игла, модифицированной Дульбекко (DMEM / F12, Sigma-Aldrich, США), 2% FCS фетальной сыворотки теленка (PAA, Австрия), 10 мг / мл аскорбиновой кислоты (Sigma-Aldrich, США), 0.05 μ M дексаметазон (Sigma-Aldrich, США), 200 мМ L-глутамин (Invitrogen, США), 10 мг / мл гентамицина (Invitrogen, США), 10 000 единиц / мл пенициллина и 10 000 единиц / мл пенициллина и 10 000 μ г / мл стрептомицин (Invitrogen, США). Клетки культивировали при 38,5 ° C в аэробных условиях (5% CO 2 ). После того, как адгезивные клетки сливались более чем на 80%, их отделяли с помощью 0,05% трипсина-ЭДТА (Invitrogen, США) в течение 4 минут и подсчитывали с помощью счетчика Z2 или анализатора жизнеспособности клеток Vi-Cell XR 2.03 (оба — Beckman Coulter, США).

2.3. Выращивание ГХ in vitro с использованием клеточного анализатора в реальном времени (RTCA)

Восстановленные ГХ были перенесены в E-Plate 16 анализатора клеток в реальном времени (RTCA, Roche-Applied Science, GmbH, Пенцберг, Германия), состоящего из анализатор RTCA, станция RTCA SP и программное обеспечение RTCA. Затем ГХ культивировали в 200 мкл л стандартной культуральной среды для ИВМ свиней, которая состояла из среды Игла, модифицированной Дульбекко (DMEM / F12, Sigma-Aldrich, США), как упомянуто выше. GC культивировали в течение 0–168 ч при 38.5 ° C при 5% CO 2 . Среду культивирования меняли каждые 44 часа. В первом эксперименте ГХ были дополнены 1,8 и 3,6 мк M E2 в начале эксперимента (0 ч). Одновременно во втором эксперименте ГК были дополнены такими же дозами E2 через 96 ч, во время логарифмического увеличения пролиферации (логарифмическая фаза). После каждого этапа культивирования ГК обрабатывали трипсином (0,25% трипсина в сбалансированном солевом растворе, Sigma-Aldrich, Сент-Луис, Миссури, США), и для оценки использовали клеточный индекс (CI) и нормализованный клеточный индекс. относительные и количественные изменения электрического сопротивления ячейки.Состояние клеток определяли с помощью программного обеспечения RTCA.

2.4. Анализ RT-qPCR экспрессии мРНК Cx36, Cx37, Cx40, Cx43, LHR, FSHR и CYP19A1 в GC

Общая РНК была выделена из GC до (через 0 ч) и после (24, 48, 72, 96, 120, 144 и 168 ч) IVC с использованием мини-колонки RNeasy от Qiagen GmbH (Хильден, Германия). Образцы РНК ресуспендировали в 20 мкл л воды, свободной от РНКазы, и хранили в жидком азоте. Затем образцы РНК обрабатывали ДНКазой I и подвергали обратной транскрипции (RT) в кДНК.RT-qPCR проводили с использованием системы обнаружения LightCycler RT-qPCR (Roche Diagnostics GmbH, Mannheim, Germany) с SYBR® Green I в качестве детектирующего красителя, и целевую кДНК определяли количественно с использованием метода относительной количественной оценки. Относительное количество транскриптов Cx36, Cx37, Cx40, Cx43, LHR, FSHR и CYP19A1 в каждом образце стандартизировали по внутреннему стандарту глицеральдегид-3-фосфатдегидрогеназы (GAPDH). Для амплификации 2 мкл раствора кДНК л добавляли к 18 мкл мкл QuantiTect® SYBR Green PCR (Master Mix Qiagen GmbH, Hilden, Германия) и праймеров (таблица 1).Один образец РНК каждого препарата обрабатывали без RT-реакции, чтобы обеспечить отрицательный контроль для последующей ПЦР.


Ген Регистрационный номер гена Последовательность праймера (5′-3 ‘) Размер продукта (п.о.)

CYP19 NM_214429. 1 AAAGACGCAGGATTTTCACA
TCTTTTGTCAGTTCACCACGT
97
FSHR NM_214386.2
GAATTGAAAAGGCCAACAAC CTTTCAAAACTTAGTCCCACG
214
LHR NM_214449.1
AAGCACAGCAAGGAGACCAA AAGAGGACAGTCACGTTTCC
231
Cx36 XM_001924757.4
AGCAGCACTCCACTATGATCGG TGTTGCACACAAACATGGTCT
123
Cx37 NM_001244224.1 GTGTGTCCGCACCGCCACCGATGA
ACAGGACCGTCAGCCAGA
155
Cx40 XM_003130802.2
ATCGCTTTCACCTGCAAGTCC CGCCATCCTCAGCAGAACCAT
220
Сх43 NM_001244212.1
CAGCACTTTTCTTTCATTAGGGGC CTAAGGACTCCAGTCACC
194
ACTB XM_003124280.3
CCCTTGCCGCTCCGCCTTC GCAGCAATATCGGTCATCCAT
69
PBGD NM_001097412.1 GAGAGTGCCCCTATGATGCT
ATGATGGCACTGAACTCCT
214

. актин (ACTB) и порфобилиноген дезаминаза (PBGD).Чтобы гарантировать достоверность этих результатов, дополнительный ген 18S рРНК домашнего хозяйства использовали в качестве внутреннего стандарта, чтобы продемонстрировать, что мРНК ACTB и PBGD не регулируются по-разному в группах GC. Экспрессия 18S рРНК была идентифицирована как подходящий ген домашнего хозяйства для использования в количественных исследованиях ПЦР. Экспрессию мРНК ACTB, PBGD и 18S рРНК измеряли в образцах кДНК из изолированных GC.

2,5. Статистический анализ

Односторонний дисперсионный анализ с последующим апостериорным тестом Тьюки был использован для сравнения результатов количественной оценки индекса распространения в реальном времени.Эксперименты проводились как минимум в двух повторностях. Результаты количественной оценки индекса пролиферации клеток были получены с использованием системы RTCA. Различия считались значительными при анализах RT-qPCR и RTCA, и их оценивали путем сравнения результатов, полученных в пяти повторах одних и тех же восстановленных клеток гранулезы. Статистические расчеты применялись к наивысшему нормализованному индексу пролиферации в каждый момент времени для каждой исследуемой группы для целей сравнения.Все статистические анализы были выполнены с использованием программного обеспечения GraphPad Prism версии 4.0 (GraphPad Software, Сан-Диего, Калифорния).

3. Результаты

Используя анализ RT-qPCR, мы проанализировали относительное количество мРНК Cx36, Cx37, Cx40, Cx43, LHR, FSHR и CYP19 после каждого периода пролиферации в режиме GC в реальном времени in vitro. Два гена домашнего хозяйства, ACTB и PBGD (данные не показаны), использовали для нормализации анализов RT-qPCR от образца к образцу. Цель состояла в том, чтобы проверить, изменился ли профиль экспрессии мРНК среди групп.Кроме того, были применены два гена домашнего хозяйства для проверки общей эффективности выделения РНК.

Мы обнаружили повышенную экспрессию мРНК Cx36 в контроле (необработанные клетки) через 0 ч IVC (), тогда как через 24 ч IVC более высокий уровень этого транскрипта наблюдался в группе, получавшей пролонгированный E2 (). Между 48 и 168 часами мы не определяли различий между группами. Острое лечение E2 показало аналогичное уменьшенное влияние на экспрессию мРНК Cx36 (рис. 1). Транскрипт Cx37 выявил повышенную экспрессию через 0, 120 и 144 часа в контрольной группе по сравнению с группой, получавшей пролонгированное лечение E2 () (фигура 2).МРНК Cx40 имела повышенную экспрессию в группе, получавшей пролонгированный E2, через 0, 24 и 72 часа по сравнению с необработанными контролями () (рис. 3). Точно так же Cx43 демонстрировал более высокую экспрессию через 0 и 24 часа в группе, обработанной E2 (), и через 48 и 72 часа (), по сравнению с необработанными контролями (Рисунок 4). Уровень мРНК LHR увеличивался через 0, 24, 48, 72, 96 и 120 ч в группе, получавшей пролонгированный E2, по сравнению с контролем (и, соответственно) (фиг. 5). Напротив, относительное количество мРНК FSHR увеличивалось через 72 часа в группе, получавшей E2 ().Транскрипт FSHR был более выражен в контроле через 0, 96, 120 и 144 ч по сравнению с группой, обработанной E2 (, и, соответственно) (фиг.6). Подобно LHR, количество мРНК CYP19A1 увеличивалось через 0, 24 и 48 ч в группе, получавшей E2, по сравнению с контрольной (,), но повышенные уровни транскрипта CYP19A1 наблюдались через 144 и 168 ч в контрольной группе (Рисунок 7). .








Используя систему RTCA, оценивали индекс пролиферации (PI) и эффекты острого и длительного лечения E2.В первом эксперименте свиньи GC культивировали с 1,8 и 3,6 мк M E2 в начале эксперимента (0 ч), который был разделен на три периода времени: 0–168 ч (рис. 8 (а)), 0–56 ч (рис. 8 (б)) и 56–90 ч (рис. 8 (с)). При анализе полного периода культивирования мы обнаружили значительное увеличение ИП в контрольной группе по сравнению с группами, обработанными 1,8 и 3,6 M E2 (и, соответственно) (рис. 8 (а)). Между 0 и 56 часами НПВ различий в значении PI не наблюдалось (рис. 1).Однако в течение последнего периода культивирования более высокий ИП в контрольной группе был определен для обеих доз 1,8 и 3,6 мкМ M E2 (и, соответственно) (рис. 8 (c)).

Во втором эксперименте оценивали влияние острого лечения E2 на GC во время логарифмического увеличения пролиферации. Точно так же ИП оценивался в три разных периода времени. При анализе полных периодов культивирования 0–168 ч мы не наблюдали различий в PI между контрольной и экспериментальной группами (рис. 9 (а)).ГХ обрабатывали 1,8 и 3,6 мкл M E2 через 96 ч культивирования (рис. 9 (б)). Впоследствии мы наблюдали значительное увеличение PI после обработки 1,8 и 3,6 M E2 по сравнению с контролем (и, соответственно) (Рисунок 9 (c)). 9. Обсуждение.Эти модификации включают (1) накопление мРНК и белков в цитоплазме ооцита (созревание цитоплазмы), (2) хромосомную реорганизацию (ядерное созревание), (3) рост кумулюсных клеток (CC) и (4) активацию двунаправленных CC-ооцитов. контакт через щелевые соединения (GJC). У нескольких видов млекопитающих было обнаружено, что правильные перекрестные помехи необходимы для прогрессирующего роста ооцитов, пролиферации и дифференцировки CC [10, 11]. Более того, отсутствие слоев кучевых офоров и / или расширенных кучевых облаков после созревания являются основными причинами нарушений во время оплодотворения и образования зиготы [12].Структура пептида GJC состоит из нескольких коннексинов (Cxs), которые отвечают за перемещение небольших веществ между CC и ооцитами. Наши предыдущие результаты показали экспрессию и возможную функцию Cxs в GC свиней во время краткосрочного первичного культивирования в реальном времени [2]. Фолликулярные GC свиней использовались в качестве модели исследования, где оценивалось влияние E2 на паттерн экспрессии Cxs (Cx36, Cx37, Cx40 и Cx43) во время краткосрочного культивирования in vitro (IVC) в режиме реального времени GC. Во время созревания КОК млекопитающих, как in vivo, так и in vitro, кумулюсные клетки, которые плотно окружают ооцит, претерпевают значительные морфологические и биохимические модификации, процесс, также известный как расширение кумулюса.Однако до сих пор остается неясным, сопровождается ли этот уникальный процесс пролиферацией ЦК. Наши недавние исследования ясно продемонстрировали, что свиные кумулюсные ооциты, отдельные CC или GC успешно пролиферируют in vitro во время краткосрочной первичной культуры в реальном времени [4, 13]. Однако острый и / или пролонгированный эффект введения E2 на интенсивность пролиферации GC свиней in vitro еще предстоит исследовать. Мы обнаружили, что при длительном лечении Е2 применяли в дозах 1,8 и 3 раза.6 μ M, приводит к снижению интенсивности пролиферации GC, когда клетки входят в логарифмическую фазу пролиферации между 72 и 96 часами IVC. Однако острое лечение E2 приводит к увеличению PI после приема обеих доз гормона. Остается неясным, проявляют ли различные периоды времени введение E2 различные эффекты на пролиферацию GC. Мы предположили, что временные изменения интенсивности пролиферации ГК свиней in vitro могут быть связаны со специализацией и повышенной специфичностью или жизнеспособностью клеток после 72 часов НПВ.Хорошо известно, что ГК претерпевают существенную трансформацию в лютеиновые клетки после 48–72 часов культивирования in vitro. Следовательно, можно предположить, что дифференциальный эффект лечения острым E2 регулируется специфической реакцией ГК на гормональную стимуляцию. Хотя профиль стероидных гормонов в исследовании не оценивался, мы предполагаем, что пролонгированный эффект лечения E2 может действовать через различные механизмы во время трансформации GC-лютеиновых клеток и / или значительно изменять этот процесс in vitro.

Существуют минимальные данные, указывающие на то, что экспансия CC связана со значительными изменениями биохимической пролиферации экспрессии целевого гена. В текущем исследовании мы оценили профиль экспрессии Cxs, которые функционируют как маркеры коммуникации CC-ооцитов, и активность GJC во время кратковременной пролиферации клеток в реальном времени. Мы обнаружили, что профиль экспрессии Cxs в течение 168 ч IVC существенно изменился. Кроме того, также наблюдалось острое и / или продолжительное действие добавок E2 на пролиферацию клеток.Широко известно, что E2 имеет решающее значение для правильных функций репродуктивных процессов у млекопитающих, особенно в регуляции фолликулогенеза и оогенеза. Более того, эстроген, вырабатываемый зрелым фолликулом яичника, является важным фактором пролиферативной фазы эндометрия. Однако до конца не выяснено, влияет ли E2 на активность GJC через повышающую регуляцию экспрессии Cx. Результаты текущего исследования ясно продемонстрировали, что E2 может модулировать экспрессию Cx после острого и / или длительного лечения, и он может быть потенциальным фактором, связанным с паракринной активностью как ооцитов, так и CC во время индукции перекрестных помех между гаметами и соматическими клетками.”

Роль гормонов эстрогена и прогестерона на экспрессию Сх в различных типах ткани яичников недавно была исследована на нескольких видах млекопитающих [14, 15]. Однако влияние E2 на профиль экспрессии Cx в GC и CC неизвестно. Роль Cxs в регуляции роста, развития ооцитов и дифференцировки окружающих CCs посредством индукционной активности GJC широко признана [16]. Также хорошо известно, что этот процесс регулируется факторами, то есть гормонами, которые действуют через паракринную секрецию.Однако механизмы, которые регулируют активность GJC и / или пути коммуникации между ооцитом и CCs, все еще нуждаются в изучении.

Недавно Saadeldin et al. исследовали взаимодействие между оголенными ооцитами свиней и GCs в юкстакринных и паракринных моделях двунаправленного взаимодействия в отношении экспрессии Cx43 [17]. Они использовали систему вставок из полиэфирной мембраны Transwell 0,4 мкм мкм, чтобы обеспечить паракринное взаимодействие ооцитов и гранулезных клеток в модели сокультивирования. Более высокая скорость партеногенетического образования бластоцисты наблюдалась в модели прямой коммуникации по сравнению с паракринной моделью.Интересно, что также были определены изменения в стероидных профилях, таких как P4 и E2, и экспрессия мРНК ферментов, критических для стероидогенеза, после 22 и 44 часов моделей юкстакринной и паракринной коммуникации. Экспрессия Cx43 была значительно выше в модели прямого контакта GC, чем в системе непрямого совместного культивирования. Эти результаты подтверждают предыдущее наблюдение, что модель прямого контакта для культивирования ГК in vitro выявила лучшие условия для роста ооцитов и дифференциации ГК.

Точно так же наши результаты показали связь между PI во время краткосрочного культивирования свиней GC in vitro и профилем экспрессии выбранных Cx в отношении стимулирующего эффекта введения E2. В нашем недавнем исследовании мы исследовали экспрессию выбранных коннексинов, таких как мРНК Cx36, Cx37, Cx40 и Cx43, с помощью RT-qPCR, а также распределение белков Cx30, Cx31, Cx37, Cx43 и Cx45 в ГК свиней в течение короткого периода времени. (168 ч), пролиферация клеток in vitro в реальном времени [2].Мы наблюдали повышенную экспрессию мРНК Cx36, Cx37 и Cx43 в GC при восстановлении по сравнению со всеми проанализированными периодами времени IVC (24, 48, 72, 96, 120, 144 и 168 ч;). Более того, паттерны экспрессии белков Cx31, Cx37 и Cx45 были увеличены до (0 часов) по сравнению с 168 часами IVC. Точно так же значение PI увеличивалось между 72 и 96 часами НПВ. Принимая во внимание оба этих результата, мы предполагаем, что снижение экспрессии Cxs и / или распад GJC во время IVC может быть в значительной степени связано с дифференцировкой GC в лютеиновые клетки in vitro.

Эффект тестостерона на секрецию 17-бета-эстрадиола в связи с активностью ароматазы был ранее исследован с использованием модели крыс GC Lee et al. [18]. Авторы обнаружили, что лечение тестостероном (0,1 и 1 мкл мкг / мл) увеличивает активность ароматазы и секрецию 17-бета-эстрадиола. Более того, более высокие дозы тестостерона подавляют экспрессию Cx43 в ГК крыс, что устраняется добавлением кальцитриола (1,25-D3). Наше исследование показало, что мРНК CYP19A1 значительно увеличилась после лечения E2.В нашем текущем исследовании мы не оценивали концентрацию тестостерона или влияние его добавок на экспрессию CYP19A1. Однако наблюдался положительный эффект введения E2 на экспрессию ароматазы. Результаты Lee et al. согласуются с нашими выводами, поскольку была обнаружена положительная регуляция экспрессии ароматазы. Это может быть эффектом стимуляции фосфотирозином, тем самым увеличивая концентрацию и доступность 1,25-D3, который является мощным фактором индуцированной тестостероном продукции 17-бета-эстрадиола в ГК.

Функция ГК, выделенных из ооцитов молодых, средних и пожилых бесплодных пациентов, в отношении стероидогенеза, апоптоза и активности гонадотропинов во время овуляции яичников, была недавно исследована Wu et al. Как и в нашем исследовании, GC собирали из фолликулярной жидкости яичников и оценивали экспрессию FSHR, CYP19A1, HSD17B, LHR, CYP11A1 и PGR (рецептор прогестерона). Они обнаружили, что экспрессия FSHR, CYP19A1 и HSD17B была снижена в GC, выделенных от пожилых пациентов, тогда как LHR, CYP11A1 и PGR стимулировались в этой группе.Более того, пролиферация ГК in vitro была ниже, а скорость апоптоза увеличивалась у пожилых пациентов. Преждевременная лютеинизация сопровождалась возрастным снижением функции GC in vitro, тогда как добавление ФСГ в культуру предотвращало лютеинизацию GC [19].

Результаты текущего исследования показали повышенную экспрессию обоих рецепторов гонадотропина (LHR и FSHR) через 0–24 часа в необработанном контроле, тогда как наблюдалась повышенная регуляция этих генов через 48–72 часа после введения E2.Предполагается, что обработка E2 отражает стимулирующий эффект на пролиферацию GCs in vitro, способность достигать логарифмической фазы через 72 часа и экспрессию LHR. Более того, экспрессия LHR может быть признана маркером трансформации GC-лютеиновых клеток, поскольку самый высокий уровень экспрессии наблюдался между 48 и 72 часами. Кроме того, повышение уровня FSHR через 72 часа IVC также сопровождается значительным увеличением пролиферации GC свиней in vitro. У некоторых видов млекопитающих широко известно, что первичное культивирование GC и / или исследования, основанные на трансформации GC-лютеиновых клеток, являются надежной и удобной моделью фолликулогенеза яичников и могут быть признаны как специфический «отпечаток пальца» этого процесса.

Бауфельд и Ванзелоу исследовали морфологические и физиологические свойства бычьих ГК in vitro в отношении экспрессии маркеров лютеинизации и статуса метилирования [20]. Они обнаружили, что CYP19A1 является решающим ферментом в пути выработки эстрадиола, и экспрессия этого фермента связана с размером фолликулов. Только ГК, выделенные из фолликулов большего размера, характеризовались повышенной специфичностью и чувствительностью к действию ЛГ на яичники. Более того, они наблюдали значительную связь между синтезом 17-бета-эстрадиола и экспрессией CYP19A1; однако пролиферативная активность GC, измеренная по экспрессии ядерного антигена пролиферирующих клеток (PCNA), была обратимой и коррелировала с экспрессией маркеров стероидогенеза и рецепторов гонадотропина.Также определяли снижение экспрессии маркеров лютеинизации, таких как простагландин-эндопероксид-синтаза 2 (PTGS2), пентраксин 3 (PTX3), регулятор передачи сигналов G-белка 2 (RGS2) и ванин 2 (VNN2). Вопреки этим результатам, наши результаты продемонстрировали положительную корреляцию между введением E2 и пролиферативной способностью ГК свиней, культивируемых in vitro. Однако аналогичным образом наблюдалось стимулирующее действие E2 на CYP19A1. Более того, в нашем недавнем исследовании мы представили связь лютеинизации GC с экспрессией мРНК LHR, FSHR и CYP19A1 и распределением белков, кодируемых этими генами, в культуре in vitro [21].LHR и CYP19A1 были увеличены через 24 и 48 часов IVC, тогда как FSHR достиг наивысшего уровня через 0 часов. Точно так же повышенный ИП был отмечен вскоре после 24 ч НПВ. Было высказано предположение, что физиологическое состояние пролиферации ГК не связано с экспрессией маркеров лютеинизации. Сравнивая эти результаты с текущим исследованием, мы предполагаем, что только ГК, стимулированные Е2, коррелируют с увеличением ИП, что может сопровождаться существенной активацией трансформации ГК-лютеиновых клеток in vitro, даже если некоторые ГК могут отрицательно регулироваться высокая концентрация эстрогена из-за введения экзогенного E2.Более того, экспрессия коннексинов, которая является маркером активности GJC, может модулироваться добавлением E2.

Этическое одобрение

Это исследование было одобрено постановлением 32/2012 Местным этическим комитетом в Познани.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Благодарности

Это исследование стало возможным благодаря гранту № 2014/13 / D / NZ9 / 04798 «SONATA» из Польского национального научного центра и 502-14-02227367-10694 из Познаньского университета медицинских наук.

17 Биоразложение бета-эстрадиола анаэробным гранулированным илом: влияние источников железа

  • 1.

    Mnif, W. et al . Биологический анализ соединений, нарушающих работу эндокринной системы, в Тунисских очистных сооружениях. Arch. Environ. Против. Tox. 59 , 1–12 (2010).

    CAS Статья Google ученый

  • 2.

    Маникум, Т. и Джон, У. Возникновение, судьба и оценка риска для окружающей среды соединений, разрушающих эндокринную систему, на очистных сооружениях в Питермарицбурге (Южная Африка). Sci. Total Environ. 468-469 , 584–597 (2014).

    ADS CAS PubMed Статья Google ученый

  • 3.

    Хансен, П. Д. и др. . Вителлогенин — биомаркер эндокринных нарушителей. TrAC Trends в аналитической химии. 17 , 448–451 (1998).

    CAS Статья Google ученый

  • 4.

    Хуанг, Б. и др. . Возникновение, удаление и судьба гестагенов, андрогенов, эстрогенов и фенолов в шести очистных сооружениях вокруг озера Дяньчи в Китае. Environ. Sci. Загрязнение. R. 21 , 12898–12908 (2014).

    CAS Статья Google ученый

  • 5.

    Ю. Ю., Ву, Л. и Чанг, А. С. Сезонные колебания веществ, разрушающих эндокринную систему, фармацевтических препаратов и средств личной гигиены на предприятиях по очистке сточных вод. Sci. Total Environ. 442 , 310–316 (2013).

    ADS CAS PubMed Статья Google ученый

  • 6.

    Кирк, Л. А., Тайлер, К. Р., Лай, К. М. и Самптер, Дж. П. Изменения эстрогенной и андрогенной активности на разных этапах очистки сточных вод. Environ. Toxicol. Chem. 21 , 972–979 (2002).

    CAS PubMed Статья Google ученый

  • 7.

    Чен, К., Ли, З. и Хуа, X. Судьба эстрогенов в пилотной системе аноксической / кислородной очистки сточных вод со ступенчатой ​​подачей, контролируемой удалением азота и фосфора. Environ. Sci. Загрязнение. Р. 25 , 12981–12991 (2018).

    CAS Статья Google ученый

  • 8.

    Джосс, А., Андерсен, Х., Тернес, Т., Ричл, П. Р. и Зигрист, Х. Удаление эстрогенов при очистке городских сточных вод в аэробных и анаэробных условиях: последствия для оптимизации растений. Environ. Sci. Technol. 38 , 3047–3055 (2004).

    ADS CAS PubMed Статья Google ученый

  • 9.

    Hu, B. et al. . Исследование адсорбции и биодеградации эстрогена в сточных водах с помощью встроенных частиц. Китай водоснабжение и водоотведение. 32 , 72–75 (2016).

    Google ученый

  • 10.

    Цзян, Х., Ван, К., Ни, В. и Чен, С. Прогресс исследований анаэробной биологической очистки воды. Технологии. Китай Биогаз. 22 (18-21), 31 (2004).

    Google ученый

  • 11.

    Wei, L. et al. . Адсорбция Cu 2+ и Zn 2+ внеклеточными полимерными веществами (EPS) в различных илах: влияние фракционной полярности EPS на механизм связывания. J. Hazard. Матер. 321 , 473–483 (2017).

    CAS PubMed Статья Google ученый

  • 12.

    Багналл, Дж. П. и др. . Ресурсозависимое биоразложение эстрогенов и роль окисляющих аммиак и гетеротрофных бактерий. J. Hazard. Матер. 239-240 , 56–63 (2012).

    CAS PubMed Статья Google ученый

  • 13.

    Zhang, Z. et al. .Характеристики анаэробного биоразложения эстрона, эстрадиола и 17Α-этинилэстрадиола в периодических испытаниях активированного ила. Десалин. Водное лечение. 53 , 985–993 (2015).

    CAS Google ученый

  • 14.

    де Мес, Т. З. Д., Куджава-Роэлевельд, К., Зееман, Г. и Леттинга, Г. Анаэробное биоразложение эстрогенов — трудно перевариваемые. Water Sci. Technol. 57 , 1177–1182 (2008).

    PubMed Статья CAS Google ученый

  • 15.

    Иванов В., Лим Дж. Дж., Стабникова О. и Гин К. Ю. Биодеградация эстрогенов факультативными анаэробными железоредуцирующими бактериями. Process Biochem. 45 , 284–287 (2010).

    CAS Статья Google ученый

  • 16.

    Чжэн, В., Цзоу, Ю., Ли, X. & Machesky, М. Л. Судьба эстрогенового конъюгата 17Α-эстрадиол-3-сульфата в сточных водах молочных предприятий: сравнение аэробной и анаэробной деградации и образования метаболитов. J. Hazard. Матер. 258-259 , 109–115 (2013).

    CAS PubMed Статья Google ученый

  • 17.

    Ли, Х. Б. и Лю Д. Разложение 17β-эстрадиола и его метаболитов бактериями сточных вод. Загрязнение воды, воздуха и почвы. 134 , 351–366 (2002).

    ADS Статья Google ученый

  • 18.

    Фуруичи Т., Каннан К., Гизи Дж. П. и Масунага С. Вклад известных веществ, нарушающих работу эндокринной системы, в эстрогенную активность в образцах воды реки Тама из Японии с использованием инструментального анализа и анализа репортерного гена in vitro. Water Res. 38 , 4491–4501 (2004).

    CAS PubMed Статья Google ученый

  • 19.

    Van den Belt, K., Berckmans, P., Vangenechten, C., Verheyen, R. & Witters, H.Сравнительное исследование in vitro / in vivo эстрогенных свойств 17Β-эстрадиола, эстрона, 17Α-этинилэстрадиола и нонилфенола. Aquat. Toxicol. 66 , 183–195 (2004).

    PubMed Статья CAS Google ученый

  • 20.

    Чайка, К. П. и Лондри, К. Л. Анаэробная биотрансформация эстрогенов. Sci. Total Environ. 367 , 932–941 (2006).

    ADS CAS PubMed Статья Google ученый

  • 21.

    Гу, Л. и др. . Микробная трансформация 17B-эстрадиола в анаэробной водной среде опосредуется изменениями биологических свойств природных растворенных органических веществ. Sci. Total Environ. 631-632 , 641–648 (2018).

    ADS CAS PubMed Статья Google ученый

  • 22.

    Ма, Л. и Йейтс, С. Р. Взаимодействие растворенных органических веществ и эстрогенов регулирует удаление эстрогена в водной среде: обзор. Sci. Total Environ. 640-641 , 529–542 (2018).

    ADS CAS PubMed Статья Google ученый

  • 23.

    Чжан Ю., Цзин Ю., Чжан Дж., Сун, Л. и Куан, X. Характеристики реактора ZVI-UASB для очистки сточных вод азокрасителями. J. Chem. Technol. И биотехнологии. 86 , 199–204 (2011).

    Артикул CAS Google ученый

  • 24.

    Чжу, Л., Джин, Дж., Лин, Х., Гао, К. и Сюй, X. Последовательность микробного сообщества и усовершенствованный механизм анаэробного гранулированного ила на основе ZVI для обработки сточных вод, содержащих хлорнитробензолы. J. Hazard. Матер. 285 , 157–166 (2015).

    ADS CAS PubMed Статья Google ученый

  • 25.

    Чжан В., Чен Л., Чен Х. и Ся С. Влияние Fe0 / Fe 2+ / Fe 3+ на разложение нитробензола в анаэробном иле. J. Hazard. Матер. 143 , 57–64 (2007).

    CAS PubMed Статья Google ученый

  • 26.

    Фенг, Ю., Чжан, Ю., Куан, X. и Чен, С. Улучшенное анаэробное сбраживание отходов, активированных перевариванием ила, путем добавления железа с нулевым валентным содержанием. Water Res. 52 , 242–250 (2014).

    CAS PubMed Статья Google ученый

  • 27.

    Чжао, Б. и др. . Повышенная адсорбция 17Β-эстрадиола анаэробным гранулированным илом в сочетании с железом без валентности. J. Chem. Technol. И биотехнологии. 93 , 776–782 (2018).

    CAS Статья Google ученый

  • 28.

    Джосс, А., Андерсен, Х., Тернес, Т., Ричл, П. Р. и Зигрист, Х. Удаление эстрогенов при очистке городских сточных вод в аэробных и анаэробных условиях: последствия для оптимизации растений. Environ. Sci. Technol. 38 , 3047–3055 (2004).

    ADS CAS PubMed Статья Google ученый

  • 29.

    Чжэн, В., Ли, X., Йейтс, С. Р., Брэдфорд, С. А. Кинетика и механизм анаэробной трансформации стероидных эстрогенных гормонов в воде молочной лагуны. Environ. Sci. Technol. 46 , 5471–5478 (2012).

    ADS CAS PubMed Статья Google ученый

  • 30.

    Альварино, Т., Суарес, С., Лема, Дж. М. и Омил, Ф. Понимание механизмов удаления PPCP и влияния основных технологических параметров в анаэробных UASB и аэробных реакторах CAS. J. Hazard. Матер. 278 , 506–513 (2014).

    CAS PubMed Статья Google ученый

  • 31.

    Ван, Л. Трансформация типичных эстрогеновых микроорганизмов в реке Шэньчжэнь и прибрежных очистных сооружениях. Магистерская диссертация Университет Цинхуа (2017)

  • 32.

    Майкл Фарбах, Дж. К. М. Р. и Вольфганг Дотт, Дж. Х. Steroidobacter Denitrificans Gen. Nov., Sp. Ноябрь, Gammaproteobacterium, разрушающая стероидные гормоны. Инт . J. Syst. Evol. Microbiol. 58 , 2215–2223 (2008).

    Артикул CAS Google ученый

  • 33.

    Чжан, Ф., Цинь, Д., Гао, Л. и Ю, К. Микробное разложение эстрогена в окружающей среде. Бюллетень микробиологии. 39 , 711–721 (2012).

    CAS Google ученый

  • 34.

    Лю Д. Разложение 17β-эстрадиола и его метаболитов бактериями сточных вод. Water Air Soil Poll. 134 , 351–366 (2002).

    ADS Статья Google ученый

  • 35.

    Ву, Д., Чжэн, С., Дин, А., Сун, Г. и Ян, М. Эффективность анаэробной системы на основе железа с нулевым валентным содержанием железа при очистке сточных вод свиней. J. Hazard. Матер. 286 , 1–6 (2015).

    ADS CAS PubMed Статья Google ученый

  • 36.

    Лю, Г. Удаление тетрациклина из грунтовых вод с помощью Zero-Valent Iron PRB и его биологическая синергия. Магистерская диссертация . Шаньдунский университет. (2017).

  • 37.

    Chen, T. Nano-FeO, F 3 O 4 Синергетическое разложение PCB микроорганизмами77. Магистерская диссертация .Аньхойский сельскохозяйственный университет. (2011).

  • 38.

    Владимир Иванов, Дж. Дж. Л. О. Биодеградация эстрогенов факультативными анаэробными железоредуцирующими бактериями. Process Biochem. 45 , 284–287 (2010).

    Артикул CAS Google ученый

  • 39.

    Влиссидес, А., Барампути, Э. М. и Май, С. Влияние ионов двухвалентного железа на биологическую активность в реакторе UASB: математическое моделирование и проверка. Biotechnol. Bioeng. 96 , 853–861 (2007).

    CAS PubMed Статья Google ученый

  • 40.

    Чжан, Х., Тиан, Ю., Ван, Л., Ми, X. и Чай, Ю. Влияние хлорида железа на производство биогаза и ферментативную активность во время анаэробной ферментации коровьего навоза и соломы фрагмитов. Биоразложение. 27 , 69–82 (2016).

    CAS PubMed Статья Google ученый

  • 41.

    Ю., Б. и др. . Синтетический эффект на ингибирование летучих жирных кислот и увеличение производства метана путем дозирования FeCl 3 в системе термофильного анаэробного сбраживания осадка. RSC Adv. 6 , 21090–21098 (2016).

    CAS Статья Google ученый

  • 42.

    Влиссидес, А., Барампути, Э. М. и Май, С. Влияние ионов двухвалентного железа на биологическую активность в реакторе UASB: математическое моделирование и проверка. Biotechnol. Bioeng. 96 , 853–861 (2007).

    CAS PubMed Статья Google ученый

  • 43.

    Dong, L., Wu, J., Wu, H., Wu, C. & Wei, C. Продвижение Fe 0 во время анаэробного разложения нитробензола. Environ. Chem. 24 , 643–646 (2005).

    CAS Google ученый

  • 44.

    Чен., Ю.И Куан, X. Механизм и применение нулевой валентной очистки сточных вод железом. Res. Environ. Sci. 13 , 24–26 (2000).

    Google ученый

  • 17-бета-эстрадиол (E2), ELISA, 96-тест

    17-Бета-эстрадиол (E2), ELISA — это иммуноферментный анализ для количественного и чувствительного определения 17-бета-эстрадиола. Принцип набора: конкурентная реакция Тест основан на распознавании E2 специфическими моноклональными антителами.E2, присутствующий в образце, и конъюгат E2-фермент (то есть E2, меченный красящим ферментом: HRP) предварительно смешивают и добавляют в каждую лунку микропланшета, и дают возможность конкурировать за ограниченное количество сайтов связывания специфических антител, иммобилизованных на поверхности. колодцев. Когда концентрация E2 выше по сравнению с ферментным конъюгатом, E2 будет преимущественно связывать антитело и наоборот. Хромогенная реакция Несвязанные конъюгаты E2 и избыток E2-фермента вымываются.Присутствие E2 определяется добавлением хромогенного субстрата: TMB. Меченый ферментом E2, связанный с антителом E2 в планшете, катализирует превращение субстрата в окрашенный продукт. После инкубационного периода реакцию останавливают добавлением разбавленной кислоты. Например, более высокая концентрация E2 в образце приводит к меньшему количеству конъюгата антиген-фермент, связанного с сайтами связывания антитела в лунке микропланшета, вызывая более светлый цвет, то есть меньшее поглощение. Количественный анализ Стандартная кривая, кривая доза-ответ, полученная из известных концентраций стандартов E2, определяется по оптической плотности при 450 нм.Концентрация E2 в каждом образце точно рассчитывается путем интерполяции с использованием интенсивности поглощения, полученной из стандартной кривой. Функции Моноклональное антитело -17β-эстрадиол (E2) связывается исключительно с E2 и не проявляет перекрестной реакции с другими химическими веществами аналогичной структуры. Моноклональные антитела однородны по качеству, что приводит к очень незначительным вариациям от партии к партии. — Количественный анализ колеблется от 0,05 мкг / л до 1 мкг / л (ppb). — Измерение ELISA отличается высокой воспроизводимостью; коэффициент вариации (CV) в большинстве случаев составляет менее 10%.- Для анализа требуется меньше вредного растворителя, чем для инструментального анализа. -Благодаря простоте использования общее время измерения составляет всего 2,5 часа. -Набор, формат 96-луночного микропланшета, позволяет одновременно измерять несколько образцов по более разумной цене.

    17β-эстрадиол INAD № 12-671

    Молодь ручейковой форели в ручье с каменистым дном. Предоставлено: Райан Хагерти / USFWS

    .

    Сводка

    17 β -эстрадиол (E2) будет вводиться в качестве лечебного корма и доступен только в учреждениях, одобренных FDA.Основная цель исследований, проведенных в рамках INAD № 12-671, состоит в том, чтобы получить данные, оценивающие эффективность E2, вводимого в корм личиночной ручейной форели, для получения феминизированных самцов рыб, дающих икру. Вариант лечения, который разрешен для ручьей форели, — это доза 20 мг активного препарата / кг корма при 4% массы тела в день на мальков в течение 60 дней. Повторное лечение не допускается. Запрещается выпуск рыбы, обработанной E2. Этот INAD требует, чтобы все участники были одобрены группой по охране окружающей среды FDA до участия — этот обзор займет 100 дней.Чтобы принять участие в программе INAD для E2, посетите сайт сбора данных ..

    Пожалуйста, прочтите протокол исследования перед любым лечением. Он содержит протокол, паспорт безопасности данных и копию форм, которые будут использоваться в качестве руководства для сбора данных, которые будут введены в онлайн-базу данных INAD . Письмо-разрешения FDA для этого INAD в настоящее время можно получить только по электронной почте Бонни Джонсон.


    Цель / цель INAD: Собрать вспомогательные и ключевые данные, необходимые для определения эффективности 17-β-эстрадиола при скармливании ему в качестве кормовой добавки личиночного ручья для производства феминизированных самок рыб, дающих икру.

    Название препарата
    17-β эстрадиол (E2)

    Источник лекарств
    Sigma-Aldrich, Inc
    3306, 3300 S 2-я улица,
    Сент-Луис, Миссури 63118

    Целевой патоген (ы): Не применимо

    Способ применения: Лечебное кормление

    Лечебная дозировка:

    • Ручейная форель: 20 мг 17 β E2 / кг корма при 4% живой массы в день

    Схема лечения:

    Срок прекращения расследования:

    • Не выпускать обработанную рыбу E2

    Требуемые параметры теста:

    • Исследователь должен сообщить об общем поведении рыб и любых побочных эффектах, связанных с обработкой.

    Leave a Comment

    Ваш адрес email не будет опубликован.